Search Strains

More Fields
Strain Species Genotype Add
VC1845 C. elegans nhr-230(gk898) V. Show Description
Y17D7A.1. External left primer: TTTCCTACGTCACACACCCA. External right primer: AAAAATTACACAGTGCGGGC. Internal left primer: GCATCCAAGCTTCTTCCAAC. Internal right primer: TAGTGCTAATCGGGTCCCTG. Internal WT amplicon: 2252 bp. Deletion size: 1576 bp. Deletion left flank: ATTTGTGCTGTGTGCTCACAGCCGGCACGT. Deletion right flank: ACTAAGCTCACAAATGTCCCAAACGTAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1860 C. elegans nhr-262(gk897) V. Show Description
F09C6.8. External left primer: ATTTGCCGCGATTAACGTAG. External right primer: GATTTGCCCATTCTGTTGCT. Internal left primer: GACAAGCATTCTCTGCGTGA. Internal right primer: TTTCAGGCAAAGTTTGAGCA. Internal WT amplicon: 2373 bp. Deletion size: 2158 bp. Deletion left flank: TCTGCGTGATCTTTCGTGTGCAAACTGTGA. Deletion right flank: AACATATAAATTTTCCGCCAAAAATTTTCT. Insertion Sequence: ATTTTCCGCCAAAAAACTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1993 C. elegans nhr-288(gk1028) V. Show Description
Y51A2B.3. External left primer: TTCCGCTGAAATGTTTTTCC. External right primer: TCATTGAATTGTTCCTGCCA. Internal left primer: TTCTCCATATTGCCCAGACC. Internal right primer: AAATACATCCACTGGGAGCG. Internal WT amplicon: 2180 bp. Deletion size: 699 bp. Deletion left flank: TTATTCGAATTTTCAATTTTCATATAATTA. Deletion right flank: GAAACCCATTTTCATAGAAATTCTCCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2086 C. elegans nhr-237(gk1050) V. Show Description
Y46H3D.6. External left primer: TCGAATTGCATTTTGACAGC. External right primer: CGAAAAACAAGCAGCACAAA. Internal left primer: ACACGAATGCATAATTGCCA. Internal right primer: TACCGCCCAGTTTCAAGTTC. Internal WT amplicon: 2013 bp. Deletion size: 1085 bp. Deletion left flank: TCTGGGCTTCACTGATTGGGGTTAACGATT. Deletion right flank: CTTTATTAGACTCAAAGTTGTCTGAAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2317 C. elegans nhr-235(gk1085) II. Show Description
Y38E10A.19. External left primer: TTTTTCATTTTGTGTGGCGA. External right primer: AATTCTGTGGAACTCGGTGG. Internal left primer: TGCTTGGTAGCTTTGCTTCA. Internal right primer: GAGTCGTGGAGTCTTGGCAT. Internal WT amplicon: 1867 bp. Deletion size: 935 bp. Deletion left flank: ACTCAAAGCTTACGTTGGAAATTATGTCGG. Deletion right flank: CCGAAAATTTTCAAAAAATTTTAGGATCTA. Insertion Sequence: AAATTTTCCGAAAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2534 C. elegans nhr-281(gk1108) X. Show Description
F16B12.8, C24A1.3. External left primer: GCGTCCACAAAAGTGTCAGA. External right primer: GGTTTGAGAATTGCCGGATA. Internal left primer: CAACACCGTGGCATTTAGTG. Internal right primer: CCTTCACTGCACGCTAAACA. Internal WT amplicon: 1959 bp. Deletion size: 1071 bp. Deletion left flank: ACGAGGCTCAGATTGTTTATGAAATCAAAA. Deletion right flank: AAATAAAATGTGTTCTTTGGAGACAGAATA. Insertion Sequence: TTATAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2567 C. elegans nhr-209(gk1135) V. Show Description
R07B7.16. External left primer: ATGGTGCATTGATGGTCAGA. External right primer: GCGGAAAACTCCAAACGATA. Internal left primer: CTTCCTGAATCAGCACAGCA. Internal right primer: GGCCCGTCTTGTTAACTTCA. Internal WT amplicon: 2735 bp. Deletion size: 1749 bp. Deletion left flank: TACTGTGAATATTGAACTGATCCATGAAAT. Deletion right flank: ATAGAGTTTCAGCTGTCCCTGGTCTCACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2761 C. elegans nhr-243(gk1213) V. Show Description
Y80D3A.4. Identified by PCR, validated by CGH. External left primer: ATCCAAAACTTCAGAACCTAGCC. External right primer: CCCATTCTCTTCTTCTCCATCTT. Internal left primer: CCGAGTTTTTCAGAACCTAGTCA. Internal right primer: ATTTGAGATTTTCGGCTTATTCC. Internal WT amplicon: 1092 bp. Deletion size: 244 bp. Deletion left flank: TTAAAAAAAGTGTTTTCGGGAATTTCAAAA. Deletion right flank: CTGGCTGAGTTCTAGAAACATAGGTTTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2772 C. elegans nhr-201(gk1112) V. Show Description
M02H5.3. External left primer: TTGTTCCCCAGCACTTTAGG. External right primer: CTCCCGAAACACGGCTAATA. Internal left primer: TAGAACCACATGGTTTCGCA. Internal right primer: TTCCGGGTGCGAGTATTTAG. Internal WT amplicon: 1776 bp. Deletion size: 743 bp. Deletion left flank: TAAAACTCCAAATGCACTGAAAAGGCTTGC. Deletion right flank: AGCTCATTAATGCTATACAGCTATTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3243 C. elegans nhr-274(gk3116) IV; gkDf36 V; gkDf37 X. Show Description
This strain is homozygous for a deletion (gk3116) in Y41D4B.21, detectable by PCR using the following primers. External left primer: GAAACGTTGGAAAAACGGAA. External right primer: CTTTGTTCGCTGCGTAATGA. Internal left primer: CAATTTCCATACCCTCGCTC. Internal right primer: CGCACACAAGCCTTAACTCA. Internal WT amplicon: 1594 bp. Deletion size: 444 bp. Deletion left flank: ACCTCATTAGTGACAGCTCTTCGAAAGAAT. Deletion right flank: CAATTTTTTCAGACATTTTTCTGATCTCGT. Insertion Sequence: AAA. Validation: No CGH probes for gk3116. Other deletions (gkDf36, gkDf37) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3625 C. elegans nhr-286(gk3859) V. Show Description
Homozygous viable. Deletion of 72 bp with AAAAAAAAAA inserted at break. Left flanking sequence: GGCTATAAGAAGTTGGAGTGCATAAATGAC; Right flanking sequence: TTTTGATCTCAGTTATTACATTAATCAAGG. See WormBase Variation gk3859 for details.
VC3872 C. elegans nhr-239(gk3837[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCAAAATTTGAATAAAAATTGGCCGCGCTA; Right flanking sequence: TGGATGCAGTTGCTTTTTCAAGAGAAGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC437 C. elegans nhr-233(gk223) V. Show Description
Y32B12B.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC469 C. elegans +/szT1 [lon-2(e678)] I; nhr-25(ok645)/szT1 X. Show Description
F11C1.6. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok645 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC551 C. elegans nhr-233(ok770) V. Show Description
Y32B12B.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7079 C. elegans nhr-228(hd7079[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2424 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTTCAGAAGAACTGCTTCTGGGAAATGG; Right flanking sequence: GATATTGTTGGTACTCTCCACGAGCTGGAT. sgRNA #1: GATAACCAAAAGTGTCGTGG; sgRNA #2: CATTTCCTTGCAAGCCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.