Search Strains

K03E5.3. External left primer: AAAATGCGTATTTCGCAACC. External right primer: AATTTCGTTCGATGACACCC. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: TGAAGAGGAAAGACTCGGTAAAA. Internal WT amplicon: 1155 bp. Deletion size: 246 bp. Deletion left flank: GAATTAAAATAATTTATTAATTTAAATAAC. Deletion right flank: TTCCAAAAAAAAACATAAATTTCGATTATT. Insertion Sequence: CAAAAAAAAACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.4. External left primer: AAACCGCATTTGTCCGAATA. External right primer: TGCCCCCACTAACCAATATC. Internal left primer: TGTCTTAAAGCAAACGTGCAA. Internal right primer: ACTACTGCCGGCTCTATCGG. Internal WT amplicon: 1181 bp. Deletion size: 351 bp. Deletion left flank: GTTTTGATAAAGGCTTCGAATCGGAAATTC. Deletion right flank: AGGCTCCATACTTTCTGTTTATGGTTATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38E10A.8. External left primer: GGAAACCACGACGCTATCAT. External right primer: CCGCGATCCAATTCTCTAAA. Internal left primer: ACCTGATAAATCCATCCGCA. Internal right primer: GTCCGACACTTTTTGGGTTC. Internal WT amplicon: 1216 bp. Deletion size: 550 bp. Deletion left flank: ACTTTATTCATAGAGATTTGAAGCCAGAGA. Deletion right flank: AAACGATGCGCGGAACCCAAAAAGTGTCGG. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10E9.1. External left primer: AGCTGAAAAATGCTGTCGGT. External right primer: TTAAATGTGCAATGGTCCGA. Internal left primer: TACTGCACCACCGTTCAAAA. Internal right primer: CAGCTTCCTCATTTTCTGTTCTT. Internal WT amplicon: 1235 bp. Deletion size: 625 bp. Deletion left flank: AGTTGCTGGACAAAACAGCCGTGAGGAAGC. Deletion right flank: GGATACTTGAAATAAAAGGGAGCAGGAATC. Insertion Sequence: TTGAAATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11G11.2. External left primer: CGGACATTTTCCGTTCAACT. External right primer: GCATTCTGGTCCGTTTTGAT. Internal left primer: GGTGCCCAGTTGTAGAGCAT. Internal right primer: AGAAAGGAAAGACGCAGGTG. Internal WT amplicon: 1957 bp. Deletion size: 694 bp. Deletion left flank: TTTGGCACATGTGGGGGAGGATGGACAAGC. Deletion right flank: AAACTATCTACAGTAGTTCTACAGTATTCC. Validation: gk3046 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27D12.1. External left primer: GGAGCCGTCTCTCTCCTTCT. External right primer: ATGGGTCAAAAATTGCTTGC. Internal left primer: ACGTACGCTCTCTTCTACCG. Internal right primer: ACTGCAAGTAGCCGACACCT. Internal WT amplicon: 1304 bp. Deletion size: 672 bp. Deletion left flank: TCCTCTTCTCCCCAATCTATCTCTCCAAGG. Deletion right flank: CTAAAAAAAACTTGTACAAATCTTTGCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34B4.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3727 homozygotes (Unc, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGCAGCCGAAAGTATCGT. External right primer: TGGACTGACTTCAGACGACG. Internal left primer: AAGGCATAAGCTGCTCCTTG. Internal right primer: GCCTGAAAACAAAGCAGGAA. Internal WT amplicon: 1143 bp. Deletion size: 711 bp. Deletion left flank: GTGACAGATCGAATATCTGATATACTGATT. Deletion right flank: CTTCAATGTCATACTCGTAATCTTCCGCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71F9B.3. External left primer: AGCCCTGACTGGTTCACATC. External right primer: AAAAAGGGAATTTTGGTGGG. Internal left primer: GCAAAAGGTCTTGGACGATG. Internal right primer: TCATTCCATGTGATCTCGGA. Internal WT amplicon: 1215 bp. Deletion size: 860 bp. Deletion left flank: AGCGGCTTCATTTGGTGCTCGGCGTCGTCG. Deletion right flank: TTCTCCGTTCAAATCGTCGCCGTTTTCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02E12.2. External left primer: TTTTGGGCGTTTTTCTTACG. External right primer: ACAGAAGCTGTTGCCGAGTT. Internal left primer: GGAAATTTTGAACGACCACAG. Internal right primer: GAGTTGTTTTACAGGAATTCTCCA. Internal WT amplicon: 1136 bp. Deletion size: 392 bp. Deletion left flank: TTTCAAATATTCCATGACCACCCAAAAAAA. Deletion right flank: CATCCGCACAAGCTGTCTTCATCGTACTGT. Insertion Sequence: ATCTCGCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A12.7. External left primer: ATGTCCTTTTCCATCCACCA. External right primer: CACGTCTATTTTGGCCGTTT. Internal left primer: TTTGCAGGAACCGCTTTATC. Internal right primer: GCAGGTAGACATAGGCAGGTG. Internal WT amplicon: 1353 bp. Deletion size: 748 bp. Deletion left flank: CGATTTTGAACTGAGCACTGACTTCATTGT. Deletion right flank: ACATCTCTTTCATATGCACGAAAATGTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21A3.6. External left primer: CAAATTGGCGAACTTCATCC. External right primer: AAATCCGTGATTTTTCGCAC. Internal left primer: CAAGCCTGTTTATAGACTTTTGGG. Internal right primer: AATTCCACTTTCCGAGCAGA. Internal WT amplicon: 1231 bp. Deletion size: 542 bp. Deletion left flank: ATACTGATGAATAATGCGTATCTAATAACT. Deletion right flank: CTGCAAGGCACGGCAGGCATTTTTGCGCCT. Insertion Sequence: GCAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3179) in K09E4.1, detectable by PCR using the following primers. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 341 bp. Deletion left flank: CCTGGCTTCATGGCGATCTCAGGCAGGCGC. Deletion right flank: ACCAGCTGGTTCACCTGGTGCTCGGCGAGC. Insertion Sequence: TGGTTC. Validation: No CGH probes for gk3179. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04B5.5. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 247 bp. Deletion left flank: ATTCCAAAGCCTGGGCCAAATCAGGTGCTT. Deletion right flank: TGTGAGCACTGCAAAACTGGAAGATACAAT. Validation: gk3180 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28H1.2. External left primer: TTTTTAAGTCCGGCAAATGG. External right primer: ATGTTTTTGCTGTGAAGCCC. Internal left primer: AGGCGCACACTATTTTTCGT. Internal right primer: CCGGCGTATAGAAACCAGAG. Internal WT amplicon: 1306 bp. Deletion size: 543 bp. Deletion left flank: GATCAAGAAGCTCTCCGGTGAGAACATCTC. Deletion right flank: ACAAAGCTCGATTCTTCTCTCTTTTCTGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52A8.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3691 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATAATCAAGCCCAAATGCG. External right primer: CCAACAACTTGGGTTATGGC. Internal left primer: TTCCATCAGGAGAAGTTCGG. Internal right primer: ATCGCTTGCGGGTAAGATTT. Internal WT amplicon: 1318 bp. Deletion size: 393 bp. Deletion left flank: TTGTCACTTCTTCTCGAGGAGTACACTAGC. Deletion right flank: ACATGTTGAATCTCCACTTCCAGTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C41A3.1. External left primer: AAGCTTGGCGATCAGGTAGA. External right primer: CAGTTGACTCAATTTCCGCA. Internal left primer: ACGGCATAATACCGAACCAG. Internal right primer: TGCTCGTCAACAATGTTCGT. Internal WT amplicon: 1141 bp. Deletion size: 689 bp. Deletion left flank: CTCAATCCGACTCTGCGATGGAGGATATTT. Deletion right flank: GATCTGCCAGCTATTTGCTTGTGGGTTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC84.2. External left primer: GCGGTTCGGATACGAAAATA. External right primer: GTGCCTGCAAGGAGACCTAC. Internal left primer: GCAAATTATACACAGGATCCATCTAC. Internal right primer: CCTGCTCCAAAAGTAAGCCA. Internal WT amplicon: 1290 bp. Deletion size: 442 bp. Deletion left flank: ACTTGGGATGGTCGAAATATTGGCATTTTC. Deletion right flank: AGAGCTTACCCGAGTGAGTTTTTAGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 470 bp. Deletion left flank: AATGGAAACCTCATGGAAAGACTCGAAGCA. Deletion right flank: TATTCCCAATATTCATGTTCGAACAGTTTT. Insertion Sequence: CTCGATATTCTCTTCGTAATCAGGGATTATTCCGAGTTTCTGGTTCACAATCGGAAATT AATCGATTCAGAGAAGCTTATGAAAGAGGAGAGGATCTATTCCAGTATCTGGGAGGATC TATTCCAGTATCTATTCCAG. Validation: gk3182 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y63D3A.3. External left primer: TCGCCCCAAAAATAAGTGAC. External right primer: TCCGCCTTCAACTAAACCAC. Internal left primer: CACATGGGGATTGAGGTCAT. Internal right primer: CTTTGCCGCATGCAAAAT. Internal WT amplicon: 1172 bp. Deletion size: 467 bp. Deletion left flank: TAAAATGAGAACTTTGAAGCTTAGGTACCA. Deletion right flank: AAGCTATGAACTTATATACTACATATTTTT. Insertion Sequence: CGAAAGAAAGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M05B5.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3716 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGCAGTTTCAGGGTTCAAA. External right primer: CTAAGGCACTTGGCTTTTGC. Internal left primer: GGGAGGAAATTTCAAAAATGA. Internal right primer: AAAAATTTAACGCGTCGCTG. Internal WT amplicon: 1169 bp. Deletion size: 569 bp. Deletion left flank: GGAATGGCAAATTGACAGCATGAGGGTTTC. Deletion right flank: TTTTTGGGATGTTCAGCGACGCGTTAAATT. Insertion Sequence: TTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07A9.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3733 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCGATGTTTGAAAACGAA. External right primer: TTTCGGGTTGCCGAATAATA. Internal left primer: TCTTCTATTGGCAATGCAACC. Internal right primer: CTGTGAAGGTGGTGGTTACG. Internal WT amplicon: 1278 bp. Deletion size: 537 bp. Deletion left flank: CAAAATGCCAAAAATGCTAGAGCAACAAGA. Deletion right flank: ATAACACCAACATGTAGATGACCCCGGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3184) in W08D2.8, detectable by PCR using the following primers. External left primer: TGAACCATTTCACTAGCCCC. External right primer: GCTCTATCCGTTCTTCGTGC. Internal left primer: AATGATGTTCGGAAAGGCTG. Internal right primer: CATTCGGGAGTAGATGCGAT. Internal WT amplicon: 2184 bp. Deletion size: 652 bp. Deletion left flank: ATTCTCCAAAGGATTATTCAATGAGAAAAC. Deletion right flank: CTAAGTGAACTCATGTAATCAACAAAATAG. Validation: gk3184 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3027) in C03C10.2, detectable by PCR using the following primers. External left primer: ACTACCGTGCTCTTGGCACT. External right primer: TCAACCTCACCCCATTTCTC. Internal left primer: GCATGTGTCTACCATCCACG. Internal right primer: GCAGTGATTTCGGGCTGTAT. Internal WT amplicon: 2385 bp. Deletion size: 826 bp. Deletion left flank: ATGCATTGAAAGATATTCATGATATGGGAT. Deletion right flank: TCAAAACCGAATCCGGTGTATGCATTCCAT. Validation: gk3027 passed by CGH. Other deletions (gk3247, gkDf34) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3237) in F38B7.1, detectable by PCR using the following primers. External left primer: TTTATCAGGCAATCCCAACC. External right primer: CGTATGCCCTCATGTTTGTG. Internal left primer: AGTTCGAACAGCTGCCAAAT. Internal right primer: GCGACAAAGCCAATTAGTCC. Internal WT amplicon: 1490 bp. Deletion size: 243 bp. Deletion left flank: TCCAAGAATTTCAATGTATACTTCTCACAT. Deletion right flank: GAAAAATTATATCCTTTTTACTTAAATAAC. Validation: No CGH probes for gk3237. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3185) in F42A10.3, detectable by PCR using the following primers. External left primer: ATCAAATCTGGTGCCATTCAG. External right primer: AAACAAACATGTGAAAAGCGG. Internal left primer: GGGAAGTGAACACTGATTGTGA. Internal right primer: TTTCTAGAACTTTCGATCCCGA. Internal WT amplicon: 1235 bp. Deletion size: 839 bp. Deletion left flank: GGGAAGTGAACACTGATTGTGAAGAGATAT. Deletion right flank: GTCTGATGTTTATACTCTCTCCCTTGGATT. Insertion Sequence: TTGAAGA. Validation: gk3185 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3186) in Y41D4A.5, detectable by PCR using the following primers. External left primer: TTTTTATCAGGTGGAAAATGGG. External right primer: GTTATTCGTGTGTTGCCTTGAA. Internal left primer: CGGAGAAAAATTGTGTGGAAA. Internal right primer: TTTCTTCATTTCTCAGCCGAA. Internal WT amplicon: 784 bp. Deletion size: 232 bp. Deletion left flank: AATTCGTGTTTTTTAGCCTAAATTTTCGCT. Deletion right flank: TCAAGTTTTTCAGTGAAAAATTTGAAAAAA. Validation: gk3186 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E01A2.10. External left primer: CAAAACCCAGTGCTCTGTCA. External right primer: AGGCAAGCATGTCCTCAAAT. Internal left primer: TGAACAAAACCCAAGTTCCC. Internal right primer: TCGGCAAATTGATAAAATGCT. Internal WT amplicon: 1304 bp. Deletion size: 528 bp. Deletion left flank: CATCTTTCTTTATCCAATGAGATATTCCAT. Deletion right flank: AACCGCCTCTCCTGGGCACGTGTTCTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3284) in K07G5.1, detectable by PCR using the following primers. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: 608 bp. Deletion left flank: TTGAGCTCTTCGAGACACTGAAAATGAGAT. Deletion right flank: CTAGAAAAATTTAATTTTAAGTCAAGCATA. Validation: gk3284 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3285) in Y39A3CR.6, detectable by PCR using the following primers. External left primer: TGCATTTTCCAAAAGTTTAAATCA. External right primer: ACGACATTTTGTTTACAAGGAACA. Internal left primer: TCGATCAAAAACTTGGACAGC. Internal right primer: AGTGTGCATTTGATTGTCACG. Internal WT amplicon: 1494 bp. Deletion size: 353 bp. Deletion left flank: AACCACCGCTGCTCTCCGACCCGCTCGTCC. Deletion right flank: TTAGAAAAAATGGGAAAAAAAATTCTCAAA. Validation: gk3285 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3286) in Y53F4B.3, detectable by PCR using the following primers. External left primer: GAAACCGGTCTCAACACGAT. External right primer: TTGGTGTCATCGGTCAAAAA. Internal left primer: TCGGCAAATTTATCTCTCGC. Internal right primer: GCACTTTCTCGTCTGCCTTT. Internal WT amplicon: 807 bp. Deletion size: 509 bp. Deletion left flank: CGATTTCGAGAACGGTCTCCGGAAGCTCTT. Deletion right flank: TCCTCCTCGCTCATTTGCGCGATCGGAGCG. Insertion Sequence: TCATCT. Validation: gk3286 passed by CGH. Other deletion (gk3540) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11E6.1. External left primer: AAAAACGTTCTAAGGCTAAATTGCT. External right primer: AAATTCAGCACAATAGAGAATCCTG. Internal left primer: CGGTTTTAATGGCTCCAAAA. Internal right primer: CTTGAGCAGTTCGGTTGACA. Internal WT amplicon: 2099 bp. Deletion size: 464 bp. Deletion left flank: TTTTAAAAGATTTTTCGAAGCCTATTCATC. Deletion right flank: ATTCATCATGGCCCATTAATGGGTGACTGG. Validation: gk3287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69A2AR.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok98 homozygotes (paralyzed, sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGTCTTTACATCCGTCATTTCTG. External right primer: CATGATCAATAGCCTTCACATCTC. Internal left primer: AAGCGTCCAAGGCACATATCG. Internal right primer: CGTCTTCAACGCCTCGGTAG. Internal WT amplicon: 3370 bp. Deletion size: approximately 1480 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C12B.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1245 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCTGCTAGTGGCCATGTTT. External right primer: GAAATGGGTGGGCACTTAAA. Internal left primer: GCTAACATCTTGCTTTGCCC. Internal right primer: CGCGTAGAATTAAACGGGAA. Internal WT amplicon: 3125 bp. Deletion size: 1458 bp. Deletion left flank: CAGTATGCGCATCAATGGAACATTCACAAT. Deletion right flank: TTTCTTGAGTTTCTGTTTCATGAATACTCA. Insertion Sequence: TTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk2191) in Y66H1B.2, detectable by PCR using the following primers. External left primer: AGCGAGTCCAGTGTCGATTT. External right primer: ACGTGAAGCTGGAGAGCATT. Internal left primer: GACATCCTTAATCCGGACCC. Internal right primer: AGAACCAGGAGTCTACGCGA. Internal WT amplicon: 1864 bp. Deletion size: 1225 bp. Deletion left flank: ATGGATTAGATACTTCTCTTCTAACTTTAT. Deletion right flank: CATTTTTATTTCCTAGTGAATATTACCTTA. Insertion Sequence: TTTTCCCATATTTCAGATATTACTACAATACGCTCGGTA. Validation: gk3291 passed by CGH. Other deletion (gk3543) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27D6.4. External left primer: ATGTGATGGAGTGGGTGGTT. External right primer: GTTGTACCGCCAACGTCTTT. Internal left primer: ACACGAAAGGGGGAGAAAAT. Internal right primer: GATTGGACGGATCAGAAGGA. Internal WT amplicon: 1448 bp. Deletion size: 987 bp. Deletion left flank: AAATGGTTTACCCTAGGGAGAAAATGGTTT. Deletion right flank: TGAAATGTTTCATTATTACTTTTAGAAAAA. Insertion Sequence: GTGTTTCATTATATTTCATTATTT. Validation: gk3293 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1197 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGTACACATTCATCGTTGC. External right primer: CGGTATGTGTGGATGTCGAG. Internal left primer: GCAATGCTCTTCTCTGTCCC. Internal right primer: GAGATCAATTTGGCCATTCG. Internal WT amplicon: 2672 bp. Deletion size: 1008 bp. Deletion left flank: ATTTTTTAAAGAACTGGAAGAAATGCGAAT. Deletion right flank: TGTGAGTGAATATAACCAAAACACCAATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28C6.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1220 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTCCGAGTGAACTGGCT. External right primer: AGCACACATGCAGGTTGAAA. Internal left primer: CCATTTGAAGCAGCCAAGAT. Internal right primer: TACGATTTGAGGGGAGATCG. Internal WT amplicon: 2198 bp. Deletion size: 1785 bp. Deletion left flank: CTTTCTGTCGGAATTGCGAGCATCCCACGA. Deletion right flank: TTAAACTTATATTAAAGGCGCATGCCGTTT. Insertion Sequence: ACTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.5. External left primer: TGTGAATCATGCAAATCGGT. External right primer: TTCACTGCCATTGGTACGAG. Internal left primer: CGCCTACAAACTTGCTCCAT. Internal right primer: CATCTCACCATAGTTCCAAGAGC. Internal WT amplicon: 1196 bp. Deletion size: 699 bp. Deletion left flank: GAATTTTCAGGCTGACACCTCCGCTGTATG. Deletion right flank: TTTATATTTTCAGCAAGGAACAGCTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F1.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3770 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGATGATGTGCGAATTTGT. External right primer: CAATCGAACGCCTTGAAAAT. Internal left primer: CAAATCCATGATTTTCACTCCA. Internal right primer: AAGCTGAGCAATGGTTTTCTTT. Internal WT amplicon: 1241 bp. Deletion size: 653 bp. Deletion left flank: GGACGCTGGCATCAGCCGCACGGTTTTCAG. Deletion right flank: GGAACCACAGAGCAAGTTAATAAAGTTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55D10.3, K02G10.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok237 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTGTTCGGTAAGCATTGGG. External right primer: AAAGTGTGTTCCGTCCTTGG. Internal left primer: CTGCCGTGGAATCTACCTGT. Internal right primer: GCAGTCGAACAACCACTTCA. Internal WT amplicon: 3216 bp. Deletion size: 2229 bp. Deletion left flank: TTTTGAGAAGGCGGTGGAGGCATGGCAATC. Deletion right flank: TTCGCTAAAAAATTGAGCCAATTTATTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 407 bp. Deletion left flank: CAGAGGCGTTGTTGTTGGTGAGTGACTAAT. Deletion right flank: TTTGTAAATTCTGAAAAATTGCCACTTTTA. Validation: gk3296 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y79H2A.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1122 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGGAAATCGTTTTGGCAT. External right primer: TTAAAACTCCGGCCAATCAG. Internal left primer: AACCACTTTTCCTCGTCCCT. Internal right primer: TTTTCGTGGCAAATTCCTTC. Internal WT amplicon: 2630 bp. Deletion size: 1688 bp. Deletion left flank: TTTTCCACCGATTTTTAATGTTTTCGATGT. Deletion right flank: GTTTTTGCGGTTAAGCCGGTCGAAATTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02B8.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1248 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCGCGGTAATTTTTCAAC. External right primer: GCATCAGACAGTGTGGAGGA. Internal left primer: CCTTTCTTTTCACCGAGCAG. Internal right primer: GAGGGGGAATATGTGCTGAA. Internal WT amplicon: 3385 bp. Deletion size: 2391 bp. Deletion left flank: GAGCATGTGCCAACAGACGGGAACGTCAAA. Deletion right flank: AACATGTTCATAAACTTAGCATTTTCCGCT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.11. External left primer: TTGGCTGCTTGTATCGATTG. External right primer: CGAAAGACTGCGAGGAAAAC. Internal left primer: GTTTCCCTGTCGTATTTCGC. Internal right primer: ATCATTGAATCCGTTGCACA. Internal WT amplicon: 855 bp. Deletion size: 260 bp. Deletion left flank: CAGACAAGTGATTTTTGAACTATTTCGTCA. Deletion right flank: TCCTTCGCCGCTCCACCACCAAGACCAGGT. Validation: gk3124 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0228.8. External left primer: CATACATAGAGTGCCCAAGAGATG. External right primer: ATCGGTTTTTCAAATTTTGTCATT. Internal left primer: ATTTGTTTGCTTCGGAACAGAT. Internal right primer: TTTTTGGAGCTGTTTTGGAAAT. Internal WT amplicon: 1734 bp. Deletion size: 306 bp. Deletion left flank: CAACTTCTGCATAATAATTGCTCAAGAATG. Deletion right flank: CAATACTTATTGATAAGAAAAAGACAAATA. Validation: gk3093 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04B5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3064 homozygotes (mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 894 bp. Deletion left flank: AATGGGACACCGAGTTCTTGTTCTCGGAGC. Deletion right flank: TATTAAAATGCCGAGAGGAAACATGATGTC. Insertion Sequence: AGGACCAATTGGAGTCTTGAATCTTCTTACTGCTAAAGCGATAGGTGCATCAAAAGTAG TAATCACTGATTTGAACGACGAGAGACTTGCTCTTGCACGCCTATTAGNAGCTGATGCT ACAATCAATGTTATGTAATAAAGAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807