More Fields
Strain Species Genotype
VC3095 C. elegans R04B5.5(gk3180) V. Show Description
R04B5.5. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 247 bp. Deletion left flank: ATTCCAAAGCCTGGGCCAAATCAGGTGCTT. Deletion right flank: TGTGAGCACTGCAAAACTGGAAGATACAAT. Validation: gk3180 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3177 C. elegans R04B5.5(gk3064) V/nT1 [qIs51] (IV;V). Show Description
R04B5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3064 homozygotes (mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 894 bp. Deletion left flank: AATGGGACACCGAGTTCTTGTTCTCGGAGC. Deletion right flank: TATTAAAATGCCGAGAGGAAACATGATGTC. Insertion Sequence: AGGACCAATTGGAGTCTTGAATCTTCTTACTGCTAAAGCGATAGGTGCATCAAAAGTAG TAATCACTGATTTGAACGACGAGAGACTTGCTCTTGCACGCCTATTAGNAGCTGATGCT ACAATCAATGTTATGTAATAAAGAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807