| VC2712 |
C. elegans |
F52F12.7(ok3347) I. Show Description
F52F12.7. External left primer: ATTGTCGCGGAATTTTATCG. External right primer: CGATTCGTGACCGTATCCAT. Internal left primer: CAAACACCATGACGCAAAAC. Internal right primer: CGTCCGATGACCTGATTAAC. Internal WT amplicon: 1151 bp. Deletion size: 547 bp. Deletion left flank: GGAATGGAATGGAAGCTCTTCCCGAGTGGA. Deletion right flank: CTGATTTGAAAGGATACCTCCCAAAAATGA. Insertion Sequence: TTTATTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2725 |
C. elegans |
gei-1(gk3062) III; C25A8.5(gk1224) IV. Show Description
C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2726 |
C. elegans |
pfd-6(ok3600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F21C3.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3600 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 445 bp. Deletion left flank: ATTTTAAAACGTTTAAAGGTAAAATTTATT. Deletion right flank: AAAAGAAGTGAAAGAAAACAAAATTGTGTT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2727 |
C. elegans |
+/mT1 II; klp-19(ok2481)/mT1 [dpy-10(e128)] III. Show Description
Y43F4B.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCCCATGAAGTTTGTCGT. External right primer: ATTGTGCGTGAACTCTGACG. Internal left primer: TTCTCATCGACCCGATTTTC. Internal right primer: TTTGATTTCAAAAGCCTCCG. Internal WT amplicon: 3279 bp. Deletion size: 1984 bp. Deletion left flank: AGACAAAATAGGACAATGGGAAAAACAGAC. Deletion right flank: GGTGTTCATGATTCTTTGGAACAACGCACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2731 |
C. elegans |
ahcy-1(ok3601) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02F2.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3601 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGAGGAATACGAATGGTGC. External right primer: CGAAATGAGTGAAGCGTTGA. Internal left primer: CAAGGATGGACAACCACTCA. Internal right primer: CGGGTAGATGGGGAACAATA. Internal WT amplicon: 1126 bp. Deletion size: 715 bp. Deletion left flank: AAAGGGATCTGCTGCTTCCCTCAAGGCTTT. Deletion right flank: AAATTGTATTGCCCTCAAACTTCATATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2733 |
C. elegans |
C08C3.4(ok3550) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C08C3.4. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3550 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTACTTTTATGCCGGCCAAC. External right primer: AGCACTAGAAATGCGCCAGT. Internal left primer: TGTCGACGAGAACTGACATTG. Internal right primer: CTTTTCTTCAATTTCCGCGA. Internal WT amplicon: 1184 bp. Deletion size: 589 bp. Deletion left flank: GCTGTTTGGGTCACATTGAGACATGGCGCA. Deletion right flank: AGTGGTTTCCTCATTGGGCAGAAGGTGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2734 |
C. elegans |
F40G9.2(ok1784)/sC1 [dpy-1(s2170)] III. Show Description
F40G9.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1784 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGCCAGCAGTTTTCAAGG. External right primer: TTTCCAGTTGCCATAGTCCC. Internal left primer: GGAAACGTGCAAAATTCGTT. Internal right primer: ACTCGGCCTCTTCCATTTTT. Internal WT amplicon: 2481 bp. Deletion size: 1696 bp. Deletion left flank: ATTAGCAGACCCAAGTATGGTCTGCTAAATAATTAGC. Deletion right flank: TGCTAAATATTTAACAGACCCAAAACTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2735 |
C. elegans |
+/mT1 II; M142.5(ok3554)/mT1 [dpy-10(e128)] III. Show Description
M142.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3554 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCCCTCAAAAATCACGAC. External right primer: CGATTGGAAATTATCGGGAA. Internal left primer: AATGTTCAGTGTGGGTTCGC. Internal right primer: TTTTTAAATCGGCTTCAAATTCA. Internal WT amplicon: 1168 bp. Deletion size: 467 bp. Deletion left flank: TTTATCGACCCGTTTTTGTGCAGTTTCTTG. Deletion right flank: TACACGGACCACCGAACGGCTCGACAAAAC. Insertion Sequence: ACCGTTTTTGTGCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2736 |
C. elegans |
Y48E1B.2(ok3557)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
Y48E1B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3557 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCGCGTACTTCTCCAACAAT. External right primer: TCTCGCAATCGGAATCTTCT. Internal left primer: CAGCTCTCTCCACCGTCTTC. Internal right primer: ACGTTCAGGAGGTCACCAAC. Internal WT amplicon: 1169 bp. Deletion size: 674 bp. Deletion left flank: GCAAGCCTCGGGTAGATGCTTCCGGGAAGA. Deletion right flank: CAGAATCTTCTGATAGCTGGGCTCCTGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2737 |
C. elegans |
B0495.7(ok3607)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
B0495.7. Maternal effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3607 homozygotes (first-generation homozygotes viable and fertile, but F2 arrests as grotty L1 or L2). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACTCAGGATTGATCGCGT. External right primer: TTGGTGTGAATCGTCTCGAA. Internal left primer: ACACATTGGCTGATGGCATA. Internal right primer: CGTCCATCTGGATGTTTTGA. Internal WT amplicon: 1316 bp. Deletion size: 797 bp. Deletion left flank: GCAATGATAAGAAGCATTGTAATTACCATT. Deletion right flank: TCCCTTCTTCGGACCAATTCTCACAACGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2739 |
C. elegans |
+/szT1 [lon-2(e678)] I; unc-115(ok2640)/szT1 X. Show Description
F09B9.2. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2640 homozygotes (Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCATTTTGGTGACGGTGA. External right primer: AAAGGGCAATGAGTTTGCAC. Internal left primer: AGACGAGATCTGGCATCCAT. Internal right primer: GAGAAGAAGAAAAGGCGCAC. Internal WT amplicon: 1358 bp. Deletion size: 512 bp. Deletion left flank: GCAGAATAAAAATTAAAAAAAAATGTTTAA. Deletion right flank: TTGAATCAGTAGCTGGCTATAGAGCACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2740 |
C. elegans |
lgc-12(ok3546) III. Show Description
R13A5.4. External left primer: AGCGAGAGCTGGTGAAACAT. External right primer: CTCGGACAATTTTCGCGTAT. Internal left primer: CCAATTTACTCGACCTGTAAAAA. Internal right primer: TGCATCAAATTAGGTGTCCG. Internal WT amplicon: 1216 bp. Deletion size: 744 bp. Deletion left flank: ACGTAAGTTATGGTAAATAACATACTTTTT. Deletion right flank: GCAATACCGTTCCAGCATTTTCACAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2741 |
C. elegans |
frm-1(gk1225) I. Show Description
ZK270.2. Identified by PCR, validated by CGH. External left primer: AATGGTGACACGATGCTCAA. External right primer: ACACAGACACAGCAAGACGG. Internal left primer: GTTAAATTCCAGTGGCTGCG. Internal right primer: GAAGCCGATGGACAAAGAGA. Internal WT amplicon: 796 bp. Deletion size: 98 bp. Deletion left flank: AAGTGATCATTCGACCTTTAAAAGTGATGT. Deletion right flank: TTTGGGTGTACCAGTTAGATATATTGGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2742 |
C. elegans |
unc-30(gk3024) Y67A10A.104(gk3025) IV; str-183(gk3061) V; ZC374.2(gk1222) X. Show Description
ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2743 |
C. elegans |
ZC374.2(gk1220) X. Show Description
ZC374.2. Identified by PCR, validated by CGH. External left primer: CGCTATCCGTTCTCTTTTGC. External right primer: GACAGGTGTGCGAGGTATGA. Internal left primer: ATACCTTTCCGACGTGCAAT. Internal right primer: AATATGACGAAATGTGGCCC. Internal WT amplicon: 2736 bp. Deletion size: 940 bp. Deletion left flank: GATAATGAATGTGAAAGAATGAAGTTAATT. Deletion right flank: CTTACAAATTGCAGAACTATTTATTAGAAT. Insertion Sequence: AGAAAGAATGAAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2744 |
C. elegans |
acs-1(gk3066) V/nT1 [qIs51] (IV;V). Show Description
F46E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3066 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCGATCAGCAGTTGACCA. External right primer: CAAAGTTGGCAATGGTTGTG. Internal left primer: CAACACAGTTTGCCAGTGCT. Internal right primer: GAGACGACTTGCTGGAGACC. Internal WT amplicon: 2067 bp. Deletion size: 880 bp. Deletion left flank: TTTATTTTAAAAAATATTTAAAAAGTTTTA. Deletion right flank: TATGACTGACATGCAAGTATGCTATGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2754 |
C. elegans |
hsp-60(ok3508)/sC1 [dpy-1(s2170)] III. Show Description
Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2755 |
C. elegans |
F01D4.3(gk1221) IV. Show Description
F01D4.3. Identified by PCR, validated by CGH. External left primer: TCCTCCAATGGTGGTTGACT. External right primer: CCGGATGGAGACAAAAAGAA. Internal left primer: ATCACTTGCTCCGGTTTCAC. Internal right primer: CCAATTCAGTCTGATGGCAA. Internal WT amplicon: 1179 bp. Deletion size: 505 bp. Deletion left flank: TTTCTCCGCAATCGGTACAACAGTTCCAGT. Deletion right flank: CGCTATTCCAAATACATTTTTCTTTTCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2759 |
C. elegans |
C40D2.4(gk3018) II. Show Description
This strain is homozygous for a deletion (gk3018) in C40D2.4, detectable by PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 847 bp. Deletion left flank: GGAAATTCATTTTATCGATTTTTCATATAA. Deletion right flank: CTCATAATAATTTAATATATGTGACGTTGA. Validation: gk3018 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2760 |
C. elegans |
ZK524.4(gk1212) I. Show Description
ZK524.4. Identified by PCR, validated by CGH. External left primer: GAAGTACCTGCTGCTTTGCC. External right primer: TATATGCAACTGCGCTCCAG. Internal left primer: GCTATTGCTCCAGCAACCAT. Internal right primer: TATGTCAAATGCGCCTGAAA. Internal WT amplicon: 1629 bp. Deletion size: 823 bp. Deletion left flank: AGCATATACAAAATAACACCTAATGACCAT. Deletion right flank: CCCTGATGTGCAACGATGATTTTCGGCGGA. Insertion Sequence: GTTCAGCATGGTCAAATATAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2761 |
C. elegans |
nhr-243(gk1213) V. Show Description
Y80D3A.4. Identified by PCR, validated by CGH. External left primer: ATCCAAAACTTCAGAACCTAGCC. External right primer: CCCATTCTCTTCTTCTCCATCTT. Internal left primer: CCGAGTTTTTCAGAACCTAGTCA. Internal right primer: ATTTGAGATTTTCGGCTTATTCC. Internal WT amplicon: 1092 bp. Deletion size: 244 bp. Deletion left flank: TTAAAAAAAGTGTTTTCGGGAATTTCAAAA. Deletion right flank: CTGGCTGAGTTCTAGAAACATAGGTTTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2762 |
C. elegans |
F28D1.1(ok3338) IV/nT1 [qIs51] (IV:V). Show Description
F28D1.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3338 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCAGCTTGAACGACATGA. External right primer: AACATACTCGTGAATCCGCC. Internal left primer: GAGGAGGATCACTCGCTGAC. Internal right primer: GTCCAATTCCGAGCACATCT. Internal WT amplicon: 1167 bp. Deletion size: 433 bp. Deletion left flank: ACAGCTCGCCTCGAATTTCTTCCCCATCAT. Deletion right flank: CGTGTAAAGAGCCGTATTTGGTGCACAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2763 |
C. elegans |
myrf-1(ok3445)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2771 |
C. elegans |
Y39G8C.2(gk1099) II. Show Description
Y39G8C.2, K03H6.5. External left primer: AAAGAGTTGAAGGCAGGCAA. External right primer: TGAGGAAAATGACCGAAAGG. Internal left primer: GTCGAGCAGCAGGTAGAACC. Internal right primer: GCAAGTTTCCGGAATTGAAA. Internal WT amplicon: 2604 bp. Deletion size: 1081 bp. Deletion left flank: CGCCGGCGCTCGAGCGTTTTAGCGTGCCGA. Deletion right flank: CTTTGTGTACTGCGGCCGACGCTGCACGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2772 |
C. elegans |
nhr-201(gk1112) V. Show Description
M02H5.3. External left primer: TTGTTCCCCAGCACTTTAGG. External right primer: CTCCCGAAACACGGCTAATA. Internal left primer: TAGAACCACATGGTTTCGCA. Internal right primer: TTCCGGGTGCGAGTATTTAG. Internal WT amplicon: 1776 bp. Deletion size: 743 bp. Deletion left flank: TAAAACTCCAAATGCACTGAAAAGGCTTGC. Deletion right flank: AGCTCATTAATGCTATACAGCTATTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2773 |
C. elegans |
bub-3(ok3437) II. Show Description
Y54G9A.6. External left primer: GCCCACTTTCACCACATCTT. External right primer: AATCCACATAAAACGCTGGG. Internal left primer: AACCACGCGGAAAACAATTA. Internal right primer: GCCTATTTTCCTCGATTTTCG. Internal WT amplicon: 1127 bp. Deletion size: 335 bp. Deletion left flank: ACTATGAGATTTTTGCAATTTTCAAAAAAA. Deletion right flank: GAAGCTACGGAAACGGCGCCATCGAGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2775 |
C. elegans |
cct-2(ok3438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2776 |
C. elegans |
+/mT1 II; rnr-2(ok3357)/mT1 [dpy-10(e128)] III. Show Description
C03C10.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3357 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCTCTCGGCTTCATTCACC. External right primer: GTGTAAAGTCCGCGAAGAGG. Internal left primer: ATACTCGGAAACCCGCTTCT. Internal right primer: ATGCCTTCGAATTTACAGCC. Internal WT amplicon: 1159 bp. Deletion size: 691 bp. Deletion left flank: TTCGATGGCCACAGCGTCCTTGATGATATC. Deletion right flank: TGCCTTTTTGTAGAAGTTCCAGATGTCATG. Insertion Sequence: ATTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2777 |
C. elegans |
pas-7(ok3447)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK945.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3447 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGTGATGATCGAGGAAGCAG. External right primer: TTCGTCTCTCCCGTAAATCG. Internal left primer: AAGCAGTTGCCGCATAACTT. Internal right primer: AACGGTTCTTCTGATTTCCG. Internal WT amplicon: 1263 bp. Deletion size: 409 bp. Deletion left flank: GAATTGTGCATAAACATGTTTCTGGTTTGT. Deletion right flank: ATTCACATCCAGCTCCTCGATCTTCAGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2783 |
C. elegans |
F35G121.4(gk3152) III; hlh-34(gk1280) V. Show Description
T01D3.2, F35G12.4. The gk1280 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 245 bp. Deletion left flank: TTGCACATTTGAGGCCAATTAAGGTCACAA. Deletion right flank: TTCAAAACTTGTAACTATAATAAAATATTT. Insertion Sequence: ATTTCAGGATGTTTTTGTGAAAG. The gk3152 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2784 |
C. elegans |
+/szT1 [lon-2(e678)] I; vps-41(ok3433)/szT1 X. Show Description
F32A6.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3433 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATCCGCAATGCATAGACC. External right primer: TCCACCTCTCGCAAAGAACT. Internal left primer: TGAGGAATGGATCGTGCTTT. Internal right primer: TGTTCCACTTTTAAACCGCC. Internal WT amplicon: 1161 bp. Deletion size: 392 bp. Deletion left flank: CCAGAAGAAGCTTCTTCCATTTTTGAGAAA. Deletion right flank: ATTCGGATATTCCTAACTTGAGTGAAGCGC. Insertion Sequence: CTACCGGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2785 |
C. elegans |
lsm-4&ada-2(ok3151)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F32A5.7, F32A5.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3151 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTTGGAGGTGCGGACATTAT. External right primer: ATGATCATCCACCAACGACC. Internal left primer: GGAATGTCGTTATTCGATTTTGA. Internal right primer: TTTCGAATTGTCTTTTCGCC. Internal WT amplicon: 1193 bp. Deletion size: 437 bp. Deletion left flank: ACCACCACGACCACGGGATTGCTCGCGCTG. Deletion right flank: AATATTCATCCACGAATCGCAGGCTTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2787 |
C. elegans |
+/mT1 II; knl-1(ok3457)/mT1 [dpy-10(e128)] III. Show Description
C02F5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3457 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCGATGGAATTGGACAACA. External right primer: ATTGTAGGCCTGATGCAAGG. Internal left primer: AGGCCATAATGAAACATCGC. Internal right primer: GTGAAGGCGGCATCTAAAAT. Internal WT amplicon: 1188 bp. Deletion size: 602 bp. Deletion left flank: GAATGGGCAAACAATGGAAGCTCTGACAGA. Deletion right flank: CAGCTAAGAGGTCTCGATAAGATGGCTGTC. Insertion Sequence: GGAAATTCGAAAATGGCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2789 |
C. elegans |
C18E3.2(ok3161) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C18E3.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3161 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGGAAGTGCTCCACAAAT. External right primer: AACTCGTGTCGCTTCTGGTT. Internal left primer: CCATTGCCGAAAAAGAAGAA. Internal right primer: CACCTTTTGGAACATGTATCTG. Internal WT amplicon: 1250 bp. Deletion size: 1122 bp. Deletion left flank: AAAGAAGAAGTATGCGGATAAATGTATTCA. Deletion right flank: GAGGAAGGAGTTCAAAGGTATTTGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2791 |
C. elegans |
egl-38(ok3510) IV/nT1 [qIs51] (IV;V). Show Description
C04G2.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3510 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCCCTACCCTACCCTCTG. External right primer: CGACTCCACAGTGCTTTCAG. Internal left primer: GCCCGGTTTTACCCTGTATT. Internal right primer: TTCCGCCTCAAAAGTTTCTC. Internal WT amplicon: 1203 bp. Deletion size: 786 bp. Deletion left flank: AAAATTTTACAAATTAAGCGAATAATACTT. Deletion right flank: GCGATTACAAAATTAATTTGTATTCCTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2792 |
C. elegans |
sar-1(ok3513) IV/nT1 [qIs51] (IV:V). Show Description
ZK180.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3513 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTATGCACAAACGTCGAAGG. External right primer: TTCTCACCCCCATTTAACCA. Internal left primer: ATCCCAAGGATCCCAAAAGA. Internal right primer: AAAATGCCTGATTTACCCGA. Internal WT amplicon: 1167 bp. Deletion size: 425 bp. Deletion left flank: ATTCCTTCTCCGTATCCTTGTCGCTGAAGA. Deletion right flank: TCGTATGTGGTAAACGAAATTCCTCCGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2793 |
C. elegans |
T10B5.2(gk1153) V. Show Description
T10B5.2. External left primer: CTCGGTTTGTACCATGGCTT. External right primer: AATTTTGCGTATTGCGAACC. Internal left primer: GATCTTCCTCATCGTGCCAT. Internal right primer: AGGACATCCGGGAGAGACTT. Internal WT amplicon: 2414 bp. Deletion size: 851 bp. Deletion left flank: AAATGATAGAAGGTCTGCTGGTACTGTGTT. Deletion right flank: GTCCCTCCATCCATCTTCGATATTTTTGGT. Insertion Sequence: TTGTTTGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2795 |
C. elegans |
F36H12.9(gk1123) IV. Show Description
F36H12.9. Identified by PCR, validated by CGH. External left primer: TGTTGTGGAAGTGCAAGAGG. External right primer: CGTATCGGTTAGTCGGCATT. Internal left primer: GCCTCAGCGATATGGAGAAG. Internal right primer: AGAAATCCTTTGTCGATGCG. Internal WT amplicon: 1008 bp. Deletion size: 761 bp. Deletion left flank: TACTCCGCCTCAGCGATATGGAGAAGTTTG. Deletion right flank: ATATATTGTTTTCAGTACTTGGATACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2796 |
C. elegans |
gcy-3(gk1154) II. Show Description
R134.1. External left primer: TTGCCATGGAACTCAAACAA. External right primer: TGAGAGCAGTGCAGTATGGC. Internal left primer: TGTTTGCTTGCCATTCACTC. Internal right primer: TGCTCCTTCGACAATCACTG. Internal WT amplicon: 2561 bp. Deletion size: 1334 bp. Deletion left flank: ATGCTTCATAAGAAGCAAATGAGCATCACT. Deletion right flank: TTTATGGAGATATGACATACCCTGCAACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2800 |
C. elegans |
F15D4.3(ok3493)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3493 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 531 bp. Deletion left flank: ATTGAGTTTTTTCTATGAAAGACCTAGCGC. Deletion right flank: AAAAATAAAATAAATAACACGGAAACCGCG. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2802 |
C. elegans |
K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V. Show Description
This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2803 |
C. elegans |
rpl-31(ok3358)/hIn1 [unc-101(sy241)] I. Show Description
W09C5.6. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3358 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGTTACCATCAAGGCTCCA. External right primer: ATCGTCCCGTTTTGTGAGTC. Internal left primer: CTTCTGTTCTCCCCCAACCT. Internal right primer: TGCAAGTATGCTCCGTTGAA. Internal WT amplicon: 1101 bp. Deletion size: 640 bp. Deletion left flank: GACGGACACGAACTCTGTATGGAACGTTCT. Deletion right flank: AGTAGGAGCTTTATTTCAGAGAGAAAACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2805 |
C. elegans |
Y111B2A.1(gk1164) III. Show Description
Y111B2A.1. External left primer: GAAGCTCGAAGAGTGGGATG. External right primer: AGTGTATGCAGCGTGTTTGC. Internal left primer: CCTCTTTGAATTACCGCCAA. Internal right primer: TTTCAGATGAAACGTGCGAG. Internal WT amplicon: 2262 bp. Deletion size: 614 bp. Deletion left flank: TTAATTAATTTCACTGATTTACGCCTGTAA. Deletion right flank: AAAATTGTTTCCAGCCGCTGCGACAATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2806 |
C. elegans |
F27C8(gk1165) IV. Show Description
F27C8. External left primer: CTGGAGCATTTGATTCGGTT. External right primer: ATTCATAAACTGGGAGGGGG. Internal left primer: TCCTCAACTTCGCTTCGAGT. Internal right primer: ATTTCGAACTTCATGCGGTC. Internal WT amplicon: 2141 bp. Deletion size: 227 bp. Deletion left flank: TCTTGATTCGATTTCACAGTGATGAATCAA. Deletion right flank: AATGTTTACATTTCCATTTCCAGGTCGATT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2819 |
C. elegans |
F15D4.3(ok3521)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2820 |
C. elegans |
eat-2(ok3528)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
Y48B6A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3528 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTTTTCTCCGCACTCTGGT. External right primer: TGTGGCACAGAACTACGCTC. Internal left primer: CCAAAATGTTGCTCAACGAG. Internal right primer: CGCAAGCCTGTAAATGTGAA. Internal WT amplicon: 1182 bp. Deletion size: 614 bp. Deletion left flank: AAATGTTGCTCAACGAGATCAAAATCGATG. Deletion right flank: TAGGGGTACTGTAGGACAACTGTGGAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2824 |
C. elegans |
H28O16.1(ok2203) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2825 |
C. elegans |
rpl-30(ok3566) I/hT2g[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y106G6H.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3566 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. xternal left primer: CCAAAAACCGGAAAAAGACA. External right primer: AAAAACGTCCGATGCAATTC. Internal left primer: AGTGTTTCAAGGGAGGAGGG. Internal right primer: TCCATCCGTGACATCGTTTA. Internal WT amplicon: 1153 bp. Deletion size: 474 bp. Deletion left flank: ATTAGAAGTTCACGCAGTTATTTTTTCTAT. Deletion right flank: CTACAACGGAAACAACATTGAGCTCGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2826 |
C. elegans |
C09H10.7(ok2466)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C009H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2466 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 550 bp. Deletion left flank: TATACTTGTATGAGTGAAGAATTTGATGAT. Deletion right flank: TCATCCAGCGAACAAACCTTCCACCATCAC. Insertion Sequence: CCATCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2828 |
C. elegans |
Y79H2A.3(gk1219) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|