Search Strains

Superficially wild-type. Reference: Simske J & Dong Y. (2017). International Worm Meeting. The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis. WBPaper00051789.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Maintain at 15C. Derived from parental strains GA158 and JJ1473. Reference: Simske J & Dong Y. 2017). The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis presented in International Worm Meeting.

Dpy, Emb, Lvl, Suppressor of the lin-2 Vul phenotype, large endosomes in coelomocytes

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

C49C3.1 Homozygous. Outer Left Sequence: CTATTGTCAGGGACTCGGGA. Outer Right Sequence: TGACATGTTTCCACGGCTTA. Inner Left Sequence: CTGGAGATTTCCGACGAGAG. Inner Right Sequence: CGGGGGTATAGTGGGCTAAT. Inner Primer PCR Length: 3002. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69A2AR.4 Homozygous. Outer Left Sequence: TTCAGCTTGTCAAGGGCTTT. Outer Right Sequence: CTTCCATTGGGGAAGTTTGA. Inner Left Sequence: CCCAAAGTGATCGGAACCTA. Inner Right Sequence: GGGATTATTTGGACCCGACT. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04C9.1. Homozygous. Outer Left Sequence: AGTCCTTGGGTCTCACAACG. Outer Right Sequence: ACGATTTGTTCCTGCCAATC. Inner Left Sequence: CCGTGAAAAAGTACGCGTTT. Inner Right Sequence: GCACTCTAAACACTTCCGGC. Inner Primer PCR Length: 2570 bp. Deletion Size: 1678 bp. Deletion left flank: ACACGGGACAAGTCATCGCTACCGTGGTCG. Deletion right flank: GCGTCAATTTCGGTTCGACAAATCGTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53F8.1 Homozygous. Outer Left Sequence: GTTACTGTTTGCCCATGCCT. Outer Right Sequence: CGTCTTGTTCATCCGTTTCA. Inner Left Sequence: GAAATGCCCAAAAGTGTCGT. Inner Right Sequence: CTCGAAAATTTCCTGGAGCA. Inner Primer PCR Length: 3195. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57A10.3. Homozygous. Outer Left Sequence: TTTCGGAAATTTTATTGCGG. Outer Right Sequence: CCGTGCATTGATCACTTGTT. Inner Left Sequence: TTTGCATTCCTTCCAAATCC. Inner Right Sequence: TTGAAAACCCTCCTCGTGTC. Inner Primer PCR Length: 2930 bp. Deletion Size: 1150 bp. Deletion left flank: GTGTTTCAGGGAAAAAAATCTACAAAATTT. Deletion right flank: TATTTTTGAAGAAATTTTCTTAATTTTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 2058 bp. Deletion left flank: TGAAAATAGTACTGTAGGATTACTGGAACT. Deletion right flank: AGGCCAAGTATCCAAAGACACTCATCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M04C9.5. Homozygous. Outer Left Sequence: GCAGAAAAGTGGTGAGAGGC. Outer Right Sequence: GAGCGGTTTGGAACAATTTC. Inner Left Sequence: AATTATGACGCCACGGATTC. Inner Right Sequence: ACCGTACGCATACTCGAACC. Inner Primer PCR Length: 2997 bp. Deletion Size: 1719 bp. Deletion left flank: ATGGACAATTGGATGCATTTTCTGTAGTTG. Deletion right flank: GACTTGCTCATACCTTATTTGAATTGTGAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G10.2a Heterozygotes are WT and GFP+. Outer Left Sequence: ttgaaatttcgaagatcccg. Outer Right Sequence: catgcccgattatctccact. Inner Left Sequence: acccaccacatttcacgatt. Inner Right Sequence: ttcgattgaccctcatctcc. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0336.11 Homozygous. Outer Left Sequence: cttgcaaacagttcaacgga. Outer Right Sequence: gagatgacggcttcgaaaag. Inner Left Sequence: tgttgacgataactcctgcg. Inner Right Sequence: tcaggtaatcggatcttggc. Inner Primer PCR Length: 2704. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F43D9.5, F43D9.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.4. Homozygous. Outer Left Sequence: TCGTGGTGTCAAAATAGCCA. Outer Right Sequence: GTGAAGATTGCCGGAAGAAC. Inner Left Sequence: TCAGTTTGGCACCACGTTAG. Inner Right Sequence: CGACAATCACCCACTGTTTG. Inner Primer PCR Length: 3158 bp. Deletion Size: 959 bp. Deletion left flank: ATTTTCAGATTGTAGGCGGATATCATTGTC. Deletion right flank: GACTCAAGTGTGAAATATTTGTTGGCCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54F7.1. Homozygous. Outer Left Sequence: GTCAGCCGAATCAAAAGCTC. Outer Right Sequence: TTTCCTTCCTCTCCCGATTT. Inner Left Sequence: CCACTCTGTTGCCAATTTGA. Inner Right Sequence: GGACGAAGAGCGTCCAAATA. Inner Primer PCR Length: 2248 bp. Deletion Size: 1022 bp. Deletion left flank: TGAAACGGTTACAAAAAATTTCCTGCATTT. Deletion right flank: TCTAATTTGAACAGTTCGGTTATCCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E4.1, F45E4.7. Homozygous. Outer Left Sequence: CAAGGCAATCGTGAGTGAGA. Outer Right Sequence: TTGCATTCATTGAACCTCCA. Inner Left Sequence: AAGGAAAATGTTCGTGGTCG. Inner Right Sequence: GGATGCAAACCGACAGAGAT. Inner Primer PCR Length: 2145 bp. Deletion Size: 1065 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54H5.4. Homozygous. Outer Left Sequence: CCGAAAGAGAGTGAAGACGG. Outer Right Sequence: TTTGTTGTTCCTCCAGGTCC. Inner Left Sequence: AAAGCAAAAATGACATCGCC. Inner Right Sequence: GCAAAAGAGGATGGGAATCA. Inner Primer PCR Length: 2642 bp. Deletion Size: 1658 bp. Deletion left flank: TAGAAATCCACCATATTATACGGAAGTGAC. Deletion right flank: TACATCAAGCGAGCGATCGCCACTGCAGCG. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23H11.8. Homozygous. Outer Left Sequence: GTCGATTTCCGGTGTGTTTT. Outer Right Sequence: ACGTTGCTGAAATTTTTGGG. Inner Left Sequence: GAAACCGTGCTTTTCAAGGA. Inner Right Sequence: TTTGCCGGAAACTTCAATTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1552 bp. Deletion left flank: TGCCTACTATTAGCAATTGTGAAGAACCAA. Deletion right flank: AAAACAACGATATGCTACAAAAAATTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.3. Homozygous. Outer Left Sequence: CCATGTCAACAAAGTCCGTG. Outer Right Sequence: GAATGAAAAATCCAAGGCGA. Inner Left Sequence: CGGTAAATTTCCCCGATTTT. Inner Right Sequence: TTCGTTGGATTTTTCCTTCG. Inner Primer PCR Length: 2533 bp. Deletion Size: 1020 bp. Deletion left flank: AGGCCCCACAGAAAGGAGGCCCCACCACGG. Deletion right flank: CTTTAAACCTATGTGCACTACCAGATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28C6.6, F28C6.8. Homozygous. Outer Left Sequence: AGTGCAATTATGGGTGGAGC. Outer Right Sequence: ACGGTAGATGCAACAGGGAC. Inner Left Sequence: TCCATTCAAACCACGAGTCA. Inner Right Sequence: TTCATCATCTCCCTTTTCCG. Inner Primer PCR Length: 2510 bp. Deletion Size: 1673 bp. Deletion left flank: ACTTGTTTTATTGGACCATTTATCAATGTG. Deletion right flank: TCCACCTCGAATGCGGGAATCTCAGAACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09C5.5. Homozygous. Outer Left Sequence: TCCTCTAGCAAAACCTTCCG. Outer Right Sequence: GTGGTACACGGGAAATGGTC. Inner Left Sequence: AAAATGTTTTAAAATACAAAAGAGA. Inner Right Sequence: AGTTTCCAACCGCGCTCTAT. Inner Primer PCR Length: 1154 bp. Deletion Size: 876 bp. Deletion left flank: TTTTTTCAATTTTTTTTTTTTGTTTTTTTC. Deletion right flank: GAGGTACATATTCCTGGTATCCAAATTCCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0412.2 Homozygous. Maintain at 15C. Outer Left Sequence: cttccttctttccctcccac. Outer Right Sequence: ttgtgacaatcggaagtgga. Inner Left Sequence: gcttatccggatttgacgaa. Inner Right Sequence: catttcttggcgatcattcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22H6.5 Homozygous. Outer Left Sequence: gagatgagtcaggaccgagc. Outer Right Sequence: atcccattgcctcaccaata. Inner Left Sequence: ctgccactattgtcacaaaatct. Inner Right Sequence: gccaactctttctcagcacc. Inner Primer PCR Length: 1198. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G8AL.11 Homozygous. Outer Left Sequence: tttgacaccacacggaaaaa. Outer Right Sequence: tcacgttaagtattcccggc. Inner Left Sequence: aaaaacctcggccaccac. Inner Right Sequence: ttcgtgtcgagaccgaacta. Inner Primer PCR Length: 1195. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54B8.5 Homozygous. Outer Left Sequence: tgcgaaacattccacagaaa. Outer Right Sequence: agatggcagacacgaagaca. Inner Left Sequence: agtttccagaagtcatgccc. Inner Right Sequence: cacagagtacgcttgcaaaa. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M4.2 Homozygous. Outer Left Sequence: ttggtcctgaaggaatcgac. Outer Right Sequence: cgagtattctgagcatgcga. Inner Left Sequence: aggttacggtatctgccacg. Inner Right Sequence: caccgaacattgaaacatgg. Inner Primer PCR Length: 1306. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E2.5 Homozygous. Outer Left Sequence: ctaattgccggaatcgaaaa. Outer Right Sequence: gacacttgatggccggttac. Inner Left Sequence: cgatttgctgaatttgtgga. Inner Right Sequence: gatctttcaacgaacctacgc. Inner Primer PCR Length: 1315. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55H12.1. Homozygous. Outer Left Sequence: CTCCCTACCACGCATTGTTT. Outer Right Sequence: CCACTCCGTCACCCACTACT. Inner Left Sequence: TTGAACGTGGACTTTTCGTG. Inner Right Sequence: TGATATTCGCTCGCAGTGAC. Inner primer WT PCR product: 3669. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.10. Homozygous. Outer Left Sequence: CACGTGTAAGCTCGACTCCA. Outer Right Sequence: ACATTGAACAATGCGGAACA. Inner Left Sequence: GGCCCACTCTTTAATACGCA. Inner Right Sequence: GAACTTGCCCCCACATCTAA. Inner primer WT PCR product: 3546. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0273.2. Homozygous. Outer Left Sequence: cagattttgagccaagctcc. Outer Right Sequence: gtgaacttctcgaagacggc. Inner Left Sequence: aatcattttcccgtccgttt. Inner Right Sequence: tccagtggatagttggcct. Inner primer WT PCR product: 3185. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.30. Homozygous. Outer Left Sequence: CGTTACGGCTCTCAGACTCC. Outer Right Sequence: TGCACTGTAACGCTCACCTC. Inner Left Sequence: ATCTTGAAGCGCAAGCTGAT. Inner Right Sequence: GAACTCTGCGTCTCGACTCC. Inner primer WT PCR product: 2878. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1010.9. Homozygous. Outer Left Sequence: TCGACAGGCTTTACCGACTT. Outer Right Sequence: ACTGCAAACCGGCAATTTAC. Inner Left Sequence: TTACTCTTGAAGGCGCCAGT. Inner Right Sequence: ACTTTCGGCAAATCCTGTTG. Inner primer WT PCR product: 2920. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07A9.6. Homozygous. Outer Left Sequence: CCTCCGACTGCTCCAGTAAC. Outer Right Sequence: AAGGAATGGCTTGAAGCAGA. Inner Left Sequence: CAGCAAAGGAATTGTCCGAT. Inner Right Sequence: CCCACGACAAATTCTCGACT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.25. Homozygous. Outer Left Sequence: AACTCTTCTTCTCCGGGCTC. Outer Right Sequence: CACCTGTCTTGGCATTTCCT. Inner Left Sequence: AACGCTTACAATTCCACGCT. Inner Right Sequence: GCAGCATTTATTGTTGCGAA. Inner primer WT PCR product: 2769. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E6.2. Homozygous. Outer Left Sequence: GGCGGGAGTTTAGGAGATTC. Outer Right Sequence: AAAGGCACGGAAATTGAGAA. Inner Left Sequence: AATGACCAGGAAATGTGGGA. Inner Right Sequence: AAGTGTCAATTGGCCAGTCC. Inner primer WT PCR product: 2983. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46A5.9. Homozygous. Outer Left Sequence: tcatttcttgcagcaattcgctgttaacactgcgagagcg. Outer Right Sequence: . Inner Left Sequence: attcgaatcgatgatggagc. Inner Right Sequence: aaattgaagttgcaaacccg. Inner primer WT PCR product: 2512. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04C10.4. Homozygous. Outer Left Sequence: TGTCGCCAGTGTTGGAATAA. Outer Right Sequence: ACCGTGAAGATGGAGGTGAC. Inner Left Sequence: CGTGCGCTTCAAGTTCACTA. Inner Right Sequence: GCCAGAAGGCTACTTGGTTG. Inner primer WT PCR product: 2701. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A3.8. Homozygous. Outer Left Sequence: AGTCAGGAATTCGCTCAGGA. Outer Right Sequence: TCAATCATTGGCAGGTTTCA. Inner Left Sequence: GCTTGGCAATTCTTCTTTGC. Inner Right Sequence: TCGAAGGGATTCAATTCGTC. Inner primer WT PCR product: 3018. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25B3.3. Homozygous. Outer Left Sequence: TGTCGGCTTCTCTGTTGTTG. Outer Right Sequence: CGAGCGGTATCATTTTGGAT. Inner Left Sequence: CATACTGCCACGTGGTGAAG. Inner Right Sequence: GGAATTGCGAGCTATGGTGT. Inner primer WT PCR product: 2838. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30H6.6. Homozygous. Outer Left Sequence: CACCCCTGTCACAGACCTTT. Outer Right Sequence: CGCCAGAGAACAACAGATG. Inner Left Sequence: TGGGCACAAGTTTCATGGT. Inner Right Sequence: AATTTTCTCGCCCTCCAGAT. Inner primer WT PCR product: 2412. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03G9.1 Homozygous. Outer Left Sequence: ATTCCTGCAGCCTATCGTGT. Outer Right Sequence: GGTGGTGGTTCTGAAGTCGT. Inner Left Sequence: TCCGTTCTCTTCCTCACCAC. Inner Right Sequence: AGGCTTAGGAATGTGGGGTT. Inner Primer PCR Length: 3088. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.7. Homozygous. Outer Left Sequence: GCAGTTGTTGCACGAGAAGA. Outer Right Sequence: AGAGAGAATCCGTCAGCGAA. Inner Left Sequence: CTTGAGCCATTCTTGATCCC. Inner Right Sequence: AAGATCGCCTGAAGGGAAAT. Inner Primer wt PCR product: 2648. Deletion size: 508 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13E6.6. Homozygous. Outer Left Sequence: TTACTTTGGCCACACCATCA. Outer Right Sequence: GCATTCAAGTCAAAGGGCAT. Inner Left Sequence: CGTAGTTTGCGCACTCACAT. Inner Right Sequence: TGTAGGGATGCTATCTGGGG. Inner Primer WT PCR product: 3285. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.