| RB919 |
C. elegans |
snf-1(ok790) I. Show Description
W03G9.1 Homozygous. Outer Left Sequence: ATTCCTGCAGCCTATCGTGT. Outer Right Sequence: GGTGGTGGTTCTGAAGTCGT. Inner Left Sequence: TCCGTTCTCTTCCTCACCAC. Inner Right Sequence: AGGCTTAGGAATGTGGGGTT. Inner Primer PCR Length: 3088. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| BA1093 |
C. elegans |
snf-10(hc194) V. Show Description
Y32F6A.2 No visible phenotype in hermaphrodites. Primers: outer HES 22/228 and inner HES 229/230.
|
|
| IG1110 |
C. elegans |
snf-12(fr70) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
|
|
| IG1114 |
C. elegans |
snf-12(fr74) X; frIs7 IV. Show Description
frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Blocks inducible expression of antimicrobial peptide nlp-29 after D. coniospara infection or treatment with PMA. Maintain under normal conditions. Reference: Labed Sa, et al. PLoS One. 2012 7(3):e33887.
|
|
| OH13027 |
C. elegans |
otIs569. Show Description
otIs569 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM064dH02. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
|
|
| OH13107 |
C. elegans |
otIs570 I; him-5(e1490) V. Show Description
otIs570 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)] I. Reporter tag inserted into fosmid WRM064dH02. Him. Line 14-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
|
|
| RM2710 |
C. elegans |
snf-11(ok156) V. Show Description
Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
|
|
| RM2711 |
C. elegans |
unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
|
|
| RM2717 |
C. elegans |
snf-3(ok293) II; unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
|
|
| RM2718 |
C. elegans |
snf-3(ok293) II; snf-11(ok156) V. Show Description
Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
|
|