| OH18892 |
C. briggsae |
Cbr-unc-17(ot1440[Cbr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-unc-17 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18895 |
C. elegans |
ins-35(ot1443) V. Show Description
ot1443 is CRISPR-engineered 646 bp deletion of the ins-35 gene removing all the coding sequence except the last 7 aa, which should not be translated due to the absence of an ATG. Sequence after edit: ttctgaaatttttgaaattgtctaattttcCAGCAGACTCAGATGAACTATTCAATTAATAATTTAAGTT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH18902 |
C. elegans |
degt-1(ot1445[degt-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH18948 |
C. elegans |
ceh-44(ot1447[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH18961 |
C. tropicalis |
Ctr-nlp-3(ot1453[Ctr-nlp-3::SL2::GFP:H2B]) X. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-3 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19034 |
C. elegans |
degt-1(ot1466) V. Show Description
Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH19089 |
C. tropicalis |
Ctr-nlp-18(ot1474[Ctr-nlp-18::SL2::GFP:H2B]) II. Show Description
SL2::GFP::H2B tag inserted after STOP codon of endogenous Ctr-nlp-18 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19094 |
C. briggsae |
Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19119 |
C. elegans |
cone-1(ot1485[*syb5500[cone-1::oxGFP]]) III. Show Description
syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19120 |
C. elegans |
ceh-44(ot1486[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19123 |
C. tropicalis |
Ctr-lgc-37(ot1487[Ctr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-lgc-37 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19124 |
C elegans |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19125 |
C elegans |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. Show Description
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19186 |
C. elegans |
cone-1(ot1502[GFP::H2B::SL2::cone-1]) III. Show Description
GFP::H2B tag with SL2 inserted at N-terminus of endogenous cone-1 locus. Ubiquitous nuclear green at all stages (as early as 2-cell). GFP signal is very bright compared to C-terminal tag in OH19215. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19202 |
C. briggsae |
Cbr-eat-4(ot1507[Cbr-eat-4::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19204 |
C elegans |
golg-4(ot1508[GFP::golg-4]) III. Show Description
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19205 |
C elegans |
golg-4(ot1509[mScarlet3::golg-4]) III. Show Description
mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19206 |
C elegans |
golg-4(ot1510[mScarlet-I3::golg-4]) III. Show Description
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170.
|
|
| OH19210 |
C. elegans |
him-8(e1489) IV; unc-42(ot1187) V. Show Description
CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH19211 |
C. tropicalis |
Ctr-eat-4(ot1512[Ctr-eat-4::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-eat-4 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19212 |
C. tropicalis |
Ctr-unc-17(ot1513[Ctr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-unc-17 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19215 |
C. elegans |
cone-1(ot1514[cone-1::SL2::GFP::H2B]) III. Show Description
CRISPR reporter, substitution of SL2 for T2A. A broad nuclear expression begins around the Comma stage. Brighter expression with earlier initiation than T2A reporter. Expression becomes restricted to non-neuronal cells as animals mature to larval stages. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19219 |
C. elegans |
ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19259 |
C. briggsae |
Cbr-unc-25(ot1524[Cbr-unc-25::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19278 |
C. elegans |
aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19280 |
C. elegans |
aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19295 |
C. elegans |
unc-25(ot1536[unc-25b.1::T2A::GFP::H2B]) III; him-5(e1490) V. Show Description
CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19333 |
C. elegans |
aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19781 |
C. briggsae |
Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19827 |
C. tropicalis |
Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH2018 |
C. elegans |
mgIs18 IV; otIs35 hst-6(ot19) X. Show Description
mgIs18 [ttx-3p::GFP] IV. otIs35 [ttx-3p::kal-1 + rol-6(su1006)] X. otIs35 has been mapped to LG X between lon-2 and hst-6. Rollers. ttx-3p::GFP labels AIY interneurons. ot19 suppresses the branching phenotype of KAL-1 overexpression in AIY. hst-6(ot19) is closely linked to otIs35.
|
|
| OH2871 |
C. elegans |
che-1(ot101) I; ntIs1 V; otIs151. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. otIs151 [ceh-36p::RFP + rol-6(su1006)]. Rollers. Both ASEL and ASER show GFP expression from ntIs1.
|
|
| OH3487 |
C. elegans |
otIs114 I; cog-1(ot119) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot119. Rollers.
|
|
| OH3491 |
C. elegans |
otIs114 I; cog-1(ot123) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. ot123 is a semi-dominant deletion allele of part of the cog-1 3' UTR, a lsy-6 miRNA target. Loss of miRNA regulation leads to ectopic expression of cog-1 in ASEL, which transforms ASEL to have ASER fate. otIs114, normally expressed in only ASEL and excretory gland cells, is lost in ASEL in ot123. Animals tend not to Roll.
|
|
| OH3556 |
C. elegans |
che-1(ot124) otIs114 I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3568 |
C. elegans |
otIs114 I; cog-1(ot155) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot155. Rollers. Animals look Dpy.
|
|
| OH3645 |
C. elegans |
otIs114 I; lsy-6(ot149) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3646 |
C. elegans |
otIs114 I; lsy-6(ot150) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3679 |
C. elegans |
che-1(ot151) otIs114 I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3681 |
C. elegans |
otIs114 che-1(ot153) I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3682 |
C. elegans |
otIs114 I; lsy-12(ot154) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers. 2 ASER.
|
|
| OH3684 |
C. elegans |
otIs114 I; lsy-12(ot170) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Worms are slow growing.
|
|
| OH3754 |
C. elegans |
otIs114 I; fozi-1(ot159) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
|
|
| OH3890 |
C. elegans |
otIs114 I; ced-4(ot188) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic expression of otIs114 in the undead sister of ASEL. Rollers.
|
|
| OH3895 |
C. elegans |
otIs114 I; die-1(ot198) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3900 |
C. elegans |
otIs114 I; fozi-1(ot191) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
|
|
| OH3926 |
C. elegans |
otIs114 I; nhr-67(ot136) IV. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Shows ASE asymmetry defects. Mildly temperature sensitive. Maintain at 25C.
|
|
| OH4025 |
C. elegans |
otIs114 I; nhr-67(ot190) IV. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Shows ASE asymmetry defects.
|
|
