Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB2233 C. elegans unc-69(e587) dpy-18(e364) III. Show Description
UncDpy.
CB587 C. elegans unc-69(e587) III. Show Description
Unc. Recessive. M-MATING-NO SUCCESS.
DG728 C. elegans sma-2(e502) emb-30(tn377) ced-7(n1892) unc-69(e587) III. Show Description
Temperature sensitive emb-30 allele. Maintain at 15C. Small. Unc. Cell death abnormal.
DG796 C. elegans sma-2(e502) tnDf2/sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
Heterozygotes are SmaCed and segregate SmaCed, SmaCedUnc and dead eggs. Maintain by picking SmaCed. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
DG801 C. elegans unc-32(e189) tnDf2/sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
Heterozygotes are Ced and segregate Ced, dead eggs and SmaCedUncs. Maintain by picking Ced. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
EU2936 C. elegans unc-69(e587) klp-7(or1092) III. Show Description
Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
JK1313 C. elegans lin-12(n941) glp-1(q46)/dpy-19(e1259) unc-69(e587) III. Show Description
Heterozygotes are WT and segregate WT, Dpy(ts) Uncs, and Lag L1 lethals (not ts). Do not distribute this strain; other labs should request it from the CGC.
JK1389 C. elegans mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC.
MT4925 C. elegans glp-1(q231) ced-7(n1892) unc-69(e587) III. Show Description
Maintain at 15C. glp-1(q231) is temperature sensitive. Unc. ced-7(n1892) causes persistent cell corpes and has a maternal effect.
MT4996 C. elegans sma-2(e502) ced-7(n1892) unc-69(e587) III. Show Description
MT5523 C. elegans unc-69(e587) ced-9(n1950n2161)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.
MT7554 C. elegans sqv-3(n2842) unc-69(e587)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Sqv Uncs. n2842: mid-L4 vulva abnormal, sterile.
NJ582 C. elegans cul-1(e1756)/unc-69(e587) III. Show Description
Heterozygotes are WT and segregate WT, Unc and Long Thin Steriles (that arrest before the adult stage). cul-1 animals have excess cell divisions in post-L1 blast cell lineages. cul-1 was formerly known as lin-19.
RG3087 C. elegans dad-1(ve587[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; + /hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve587 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gtgtaacacagcaagagaaacgaaacccca ; Right flanking sequence: TTTGGTAGTCATCGAACAGTTTCGAGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.