| KG4995 |
rimb-1(ce828) III. |
Superficially wild type on plates. Slight (<10%), but significant, expansion of synaptic vesicles from the synaptic region of the DA9 motor neuron into the flanking asynaptic regions. Synaptic vesicles also showed a slight but significant accumulation in rimb-1 mutant dendrites in the DA9 motor neuron (192 +/- 32% compared to wild type; N=15; P=.015). The sequence GC TAG C TAA A TGA (3 successive stop codons in different reading frames) was inserted after codon 16 of the rimb-1 gene; described in Edwards SL, et al. (manuscript in revision). "Sentryn Acts with a Subset of Active Zone Proteins in the Guided Transport and Capture of Synaptic Vesicles in Caenorhabditis elegans." |
| KG4400 |
sad-1(ce749) X. |
Superficially wild-type on plates. Shows defects in the transport and capture of dense core vesicles and synaptic vesicles in cholinergic motor neurons. Suppresses organelle accumulation (lysosomes, early endosomes, Golgi) in axons in an unc-16(-) background. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. Genetics. 2015 Sep;201(1):117-41. |
| KG2430 |
ceIs56 X. |
ceIs56 [unc-129p::ctns-1::mCherry + nlp-21p::Venus + ttx-3p::RFP]; Maps to X: 9.0 +/ 3.0 m.u. Expresses the lysosomal membrane marker CTNS-1 in a subset of 9 DA/DB cholinergic motor neurons in the ventral cord, and NLP-21::Venus in the same neurons as a marker for soluble DCV cargo and to help identify the boundaries of the somas and axons when imaging lysosomes. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. Genetics. 2015 Sep;201(1):117-41. |
| KG4671 |
ceIs259 IV. |
ceIs259 [unc-129p::RFP::syn-13 + unc-129p::Venus + ttx-3p::RFP]; Inserted at center of LG IV. Expresses RFP::SYN-13 to mark early endosomes in a set of 9 DA/DB cholinergic motor neurons in the ventral nerve cord. unc-129::Venus fills the neuron and thus is useful for identifying regions and can also be used as a control for effects on expression of the transgene. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. (manuscript in revision). "Sentryn Acts with a Subset of Active Zone Proteins in the Guided Transport and Capture of Synaptic Vesicles in Caenorhabditis elegans." |
| KG4687 |
ceIs269 I. |
ceIs269 [unc-129p::tomm-20::Venus + unc-129p::mCherry + ttx-3p::RFP]; Integration in Chromosome I (near genetic position -3.20 or 1.14). The ttx-3 marker is quite faint in this strain especially in larvae. The tomm-20::Venus construct was injected at 0.5 ng/ ul in the strain used to make this integrant, so virtually all of the visible tomm-20::Venus signal s associated with mitochondria with essentially no background. The unc-129p::mCherry marker is expressed at a very low level that are detectable only with a sensitive camera (and often not by eye at 1000X). In strains lacking mitochondria in the dorsal cord, use the camera to focus on the mCherry in the dorsal cord, then acquire in the YFP channel. |
| KG4731 |
unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. |
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans. |
| KG5148 |
unc-104(ce833[5xMyc::AID::unc-104+sup-1(e995)]) II. |
The Auxin Inducible Degron (AID) flanked by a 5X Myc/spacer tag on left and a single spacer on the right is fused to the N-terminus of the unc-104 gene. Allows conditional degradation of UNC-104 protein when combined with tissue specific expression of TIR1 in the presence of 1 mM Auxin in plate media. Note: KG5148 does not express TIR1. On standard plates: wild type growth, appearance, and locomotion rate. For animals expressing a TIR1 transgene in the nervous system: Animals that hatch and develop on 1 mM Auxin plates generally remain tightly coiled near the location of hatching and exhibit slow growth (up to 7 days to reach adulthood, with 98% reaching adulthood by 7 days). Adults placed on Auxin abruptly lose about 75% of their locomotion function between 6 and 12 hours after plating. The remaining locomotion function is lost gradually between 12 and 52 hours. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans. |
| GS8190 |
arTi85. |
arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi85 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553. |
| GS8255 |
arTi101. |
arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553. |
| GS8729 |
arSi12. |
arSi12 [mex-5p::ERK::KTR::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi12 is a single-copy CRISPR/Cas9-engineered insertion expressing a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553. |
| GS8752 |
arSi15. |
arSi15 [mex-5p::ERK::KTR(S43A, T55A, S62A)::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi15 is a single-copy CRISPR/Cas9-engineered insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Use arSi15 as a negative control for transgene arSi12. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553. |
| RT3574 |
lin-15B&lin-15A(n765) X; ihIs35. |
ihIs35 [yap-1::GFP::unc-54 3'UTR + lin-15(+)]. Translational yap-1::GFP fusion containing 5 kb of upstream regulatory sequence and 2.5kb coding genomic sequence; inserted into pPD95.75. Integration of yap-1::GFP extrachromosomal array was performed by the UV irradiation method. Reference: Iwasa H, et al. Exp Cell Res. 2013 Apr 15;319(7):931-45. |
| PD4092 |
unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I. |
Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292. |
| RG5060 |
ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| PD2882 |
unc-54(cc2882[unc-54[G387R]::gfp::TAA::NSUTR]) I. |
cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292. |
| SSM289 |
mre-11(iow45[mre-11::gfp::3xflag]) V. |
Homozygous gfp and 3xflag C’ terminal tag inserting just before the STOP codon of mre-11. The strain is fertile and contains wild type germline (examined by DAPI). GFP is expressed in all germline nuclei. Maintain the strain by picking worms at 20C, no selection required. gfp::3xflag was added by CRISPR/Cas9 using pDD282-based vector. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441. |
| OH11876 |
pha-1(e2123) III; otIs453. |
otIs453 [itr-1::GFP::utr-1a 3' UTR + pha-1(+)]. itr-1::GFP reporter contains sequence from 2282bp upstream of exon 2 of itr-1a through end of exon 3, and carrying the utr-1a 3' UTR. Reference: Kratsios P, et al. Elife. 2017 Jul 5;6. pii: e25751. doi: 10.7554/eLife.25751. PMID: 28677525 |
| SV1619 |
dhc-1(he250[mCherry::dhc-1]) I. |
This strain carries endogenously tagged dynein heavy chain (mCherry::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038 |
| SV1803 |
dhc-1(he264[eGFP::dhc-1]) I. |
This strain carries endogenously tagged dynein heavy chain (egfp::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038 |
| SV1877 |
ebp-2(he278) II; ebp-1 & Y59A8B.25 & ebp-3(he279) V. |
he278 is a CRISPR-induced deletion of ebp-2. he279 is a deletion removing ebp-1, Y59A8B.25 & ebp-3. Low penetrance of pleiotropic phenotypes among adults, including low frequency of dumpy, sterile and/or uncoordinated animals and nonviable larvae that explode through the vulva. Some adults develop irregularities that seem to represent epidermal bulges. Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038 |
| CGC87 |
tmIn54 [umnIs69] V. |
umnIs69 [myo-2p::GFP + NeoR, V:4308261(intergenic)] V. Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7). Derived by insertion of myo-2p::GFP transgene into parental strain FX19702 using CRISPR/Cas9. |
| CGC88 |
tmIn26 [umnIs70] X. |
umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9. |
| JJ1578 |
par-6(zu222) unc-101(m1); zuIs54. |
zuIs54 [par-6p::par-6::ZF1::GFP + unc-119(+)]. Unc. GFP-tagged PAR-6 that degrades in early embryonic somatic cells; rescues the Par phenotype of par-6(zu222). Delayed gastrulation of endodermal cells. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50. |
| JJ1600 |
par-3(it71) lon-1(e185) III; him-8(e1489) IV; zuIs20. |
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50. |
| CZ9676 |
acr-2(n2595 n2420) X. |
Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. |
| CGC91 |
umnIs72 I. |
umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9. |
| EG7799 |
unc-119(ed3) III; oxTi374 V; oxEx1873. |
oxTi374 [unc-18(+) + ttTi5605 NeoR] V. oxEx1873 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi374 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in repressive region at position 3,339,184 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016). |
| EG7803 |
unc-119(ed3) III; oxTi176 V; oxEx1807. |
oxTi176 [unc-18(+) + ttTi5605 NeoR] V. oxEx1807 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi176 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a generally permissive region at position 15,383,969 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016). |
| EG7804 |
unc-119(ed3) III; oxTi173 V; oxEx1795. |
oxTi173 [unc-18(+) + ttTi5605 NeoR] V. oxEx1795 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi173 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a repressive region at position 17,523,246 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016). |
| EG7805 |
unc-119(ed3) III; oxTi357 V ; oxEx1876. |
oxTi357 [unc-18(+) + ttTi5605 NeoR] V. oxEx1876 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi357 is a Mini-Mos insertion of ttTi5605 mosSCI landing site in a repressive region at position 20,921,413 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016). |
| HMZ245 |
ccar-1(sda11) IV. |
Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10. |
| CZ24990 |
unc-44(ju1412[unc-44::GFP]) IV. |
Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707. |
| CZ25013 |
unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. |
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707. |
| LC81 |
cat-4(tm773) V. |
Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2. |
| CB3779 |
tra-2(e2021) II. |
tra-2 gain-of-function. Male-female strain. Maintain by mating. References: EMBO J. 2001 Mar 15; 20(6): 1363–1372. Proc Natl Acad Sci U S A. 2004 Aug 24; 101(34): 12549–12554. |
| EEG98 |
mudIs1. |
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158. |
| EEG108 |
mod-5(n822) I; mudIs1. |
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158. |
| BJS737 |
mpk-1(sbj10) III. |
Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404. |
| OH15227 |
unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. |
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press). |
| CB6503 |
bgIs312 I; him-8(e1489) IV; bus-17(e2923) X. |
bgIs312 [pes-6::GFP]. GFP expression in excretory cell only. Bus (resistant to infection by M. nematophilum and Leucobacter Verde2), hypersensitive to Leucobacter Verde1, bleach-sensitive, drug-sensitive; Him (high incidence of males). e2923 is a Mos1 insertion in bus-17 (ZK678.8). Reference: Yook & Hodgkin (2007), Genetics 175: 681-697 |
| AUM1054 |
gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. |
| AUM2059 |
vizSi20 II; unc-119(ed3) III. |
vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3’UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. |
| AUM2073 |
vizSi34 II; unc-119(ed3) III. |
vizSi34 [cdk-2p::GFP::tbb-2 3’ UTR + unc-119(+)] II. Superficially wild-type. vizSi34 was inserted into ttTi5605 on Chr II using MosSci. Predicted cdk-2 promoter (from WormBase) drives GFP expression. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. |
| AUM2071 |
vizSi32 II; unc-119(ed3) III. |
vizSi32 [cdk-2p(intron)::GFP::tbb-2 3’ UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. |
| NFB1369 |
ast-1(vlc19[ast-1::GFP]) II. |
vlc19[ast-1::GFP] II. Superficially wild-type. Endogenous ast-1 locus tagged with GFP using Cas9-triggered homologous recombination. GFP was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. |
| NFB1692 |
hlh-3(vlc28[hlh-3::mNeonGreen]) II. |
vlc28[hlh-3::mNeonGreen] II. Superficially wild-type. Endogenous hlh-3 locus tagged with mNeonGreen using Cas9-triggered homologous recombination. mNeonGreen was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. |
| NFB608 |
vlcEx324. |
vlcEx324 [egl-46p::NLS::DsRed + ttx-3p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional reporter for egl-46 contains NLS::DsRed fused to 4477 bp intergenic DNA. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. |
| NFB509 |
zdIs13 IV; vlcEx284. |
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. |
| AL132 |
icIs132. |
icIs132 [unc-40::GFP]. Superficially wild-type. unc-40 translational reporter. Reference: Chan SS, et al. Cell. 1996 Oct 18;87(2):187-95. |
| GR1333 |
yzIs71 V. |
yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5’ regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4. |