| SHG2244 |
henn-1(ust413[henn-1::GFP::3xFlag]) III. |
GFP::3xFlag inserted into endogenous henn-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2328 |
plp-1(ust432[plp-1::GFP::3xFlag]) IV. |
GFP::3xFlag inserted into endogenous plp-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2330 |
spn-4(ust434[spn-4::GFP::3xFlag]) V. |
GFP::3xFlag inserted into endogenous spn-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2331 |
vbh-1(ust435[vbh-1::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous vbh-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2333 |
pgl-3(ust437[pgl-3::GFP::3xFlag]) V. |
GFP::3xFlag inserted into endogenous pgl-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2361 |
mip-2(ust450[mip-2::GFP::3xFlag]) V. |
GFP::3xFlag inserted into endogenous mip-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2428 |
mut-2(ust447[mut-2::GFP::3xFlag]) I. |
3xFlag::GFP inserted into endogenous mut-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2429 |
glh-2(ust448[glh-2::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous glh-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2440 |
simr-1(ust365[simr-1::tagRFP]) I. |
tagRFP inserted into endogenous simr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG2540 |
gld-4(ust498[gld-4::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous gld-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2607 |
pid-4(ust516[pid-4::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous pid-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2672 |
gld-2(ust546[gld-2::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous gld-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2673 |
rrf-1(ust364[rrf-1::ragRFP]) I. |
tagRFP inserted into endogenous rrf-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG2701 |
nhl-2(ust586[3xFlag::GFP::nhl-2]) III. |
GFP::3xFlag inserted into endogenous nhl-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2766 |
ifet-1(ust547[ifet-1::mcherry]) III. |
mCherry inserted into endogenous ifet-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2848 |
glh-1(ust406[mCherry::glh-1]) I. |
mCherry inserted into endogenous glh-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2882 |
rde-12(ust575[3xFlag::GFP::rde-12]) V. |
3xFlag::GFP inserted into endogenous rde-12 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2904 |
npp-9(ust587[tagRFP::npp-9]) III. |
tagRFP inserted into endogenous npp-9 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2905 |
pgl-1(ust588[pgl-1::GFP::3xFlag]) IV. |
GFP::3xFlag inserted into endogenous pgl-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2907 |
rrf-1(ust590[rrf-1::GFP::3xFlag]) I. |
GFP::3xFlag inserted into endogenous rrf-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG2909 |
znfx-1(ust362[mCherry::znfx-1]) II. |
mCherry inserted into endogenous znfx-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG2957 |
gld-4(ust593[3xFlag::GFP::gld-4]) I. |
3xFlag::GFP inserted into endogenous gld-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG3113 |
hrde-2(ust625[hrde-2::GFP::3xFlag]) V. |
GFP::3xFlag inserted into endogenous hrde-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. |
| SHG357 |
ustSi32 II. |
ustSi32 [tofu-6p::tofu-6::GFP::3xFlag::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475. |
| SHG487 |
ustSi25 II. |
ustSi25 [wago-4p::3xFlag::GFP::wago-4::wago-4 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Xu F, et al. Cell rep. 2018 May 22;23(8):2482-2494. doi: 10.1016/j.celrep.2018.04.072. PMID: 29791857. |
| SHG520 |
ustSi56 II. |
ustSi56 [tofu-6p::tofu-6::mCherry::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into oxTi444 of parental strain EG8080. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475. |
| SHG659 |
ustSi106 II. |
ustSi106 [wago-1p::3xFlag::GFP::wago-1::wago-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544. |
| SHG670 |
ustSi55 II. |
ustSi55 [pid-1p::pid-1::GFP::3xFlag::pid-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475. |
| SHG763 |
prg-1(ust643[3xFlag::GFP::prg-1]) I. |
3xFlag::GFP inserted into endogenous prg-1 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475. |
| VT3824 |
alg-1(ma447) X. |
Maintain at 20C. ma447 is a F180(deletion) mimicking human AGO1 F180 mutation. Adult ma447 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| VT3809 |
alg-1(ma443) X. |
Maintain at 20C. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| UY98 |
alg-1(zen25) X. |
zen25 is a V254I substitution mimicking human AGO1 V254I mutation. Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| UY84 |
alg-1(zen18) X. |
Maintain at 20C. zen18 is a H751L substitution mimicking human AGO1 H751L mutation. Adult zen18 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| VT3805 |
maIs105 V; alg-1(ma443) X. |
Maintain at 20C. maIs105 [col-19::GFP] V. ma443 is a G199S substitution mimicking human AGO1 G199S mutation. Adult ma443 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| UY104 |
maIs105 V; alg-1(zen25) X. |
maIs105 [col-19::GFP] V. zen25 is a V254I substitution mimicking human AGO1 V254I mutation. Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| UY99 |
maIs105 V; alg-1(zen18) X. |
Maintain at 20C. maIs105 [col-19::GFP] V. zen18 is a H751L substitution mimicking human AGO1 H751L mutation. Adult zen18 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| VT1997 |
maIs105 V; alg-1(ma192) X. |
Maintain at 20C. maIs105 [col-19::GFP] V. ma192 is a S750F substitution mimicking human AGO1 S750F mutation. Adult ma192 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125. |
| ZZY861 |
unc-119(tm4063) III; ltIs44 V; stIs10024; zuIs178; zzyIs139. |
ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)]. Reference: Zhao Z, et al. https://doi.org/10.21203/rs.3.rs-4664717/v1 |
| RG3489 |
rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. |
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RSL10 |
unc-94(ftw3[GFP::unc-94]) I; myo-3(ftw6[myo-3(head)::SL2::mCherry::myo-3(tail)]) V. |
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL88 |
myo-2(ftw64[myo-2(head)::SL2::GFP::myo-2(tail)]) X. |
Severing and tagging of the endogenous locus with trans-splicing SL2 and GFP using CRISPR/Cas9. GFP expression in pharynx muscle. Impared pumping behavior, grows slowly. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL98 |
muIs252 II; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. |
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Pharynx and body muscles are green and red fluorescent and visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL99 |
muIs257 I; unc-22(ftw65[unc-22(partial)::wrmScarlet11::SL2::GFP::unc-22(partial)]) IV. |
Severing and tagging of endogenous unc-22 locus with trans-splicing ICR and GFP using CRISPR/Cas9. muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Pharynx and body muscles are green; red fluorescence only in body wall muscles. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL108 |
rpl-13(ftw73[rpl-13::SL2::GFP::dpy-10]) I. |
rpl-13(ftw73[rpl-13::SL2::GFP::dpy-10]) I. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible thoughout body by dissection fluorescence microscopy. D10 (dpy-10) CRISPR/Cas9 entry site is located downstream of the GFP coding region. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL111 |
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. |
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. dpy-10 CRISPR/Cas9 entry site is located downstream of the GFP coding region. Inverted LoxP sites flank the GFP::dpy-10 insert. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL47 |
unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I; myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. |
unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL113 |
rpl-13(ftw75[rpl-13::SL2::GFP::synzip]) I. |
Endogenous rpl-13 locus modified using CRISPR-Cas0 to co-express GFP::SYNZIP fusion by trans-splicing. Green fluorescence visible thoughout body. Off-target background mutation might be present resulting in reduced progeny. Please contact Ryan Littlefield prior to publishing work using this strain. |
| RSL123 |
dpy-10(cn64) rab-3(ftw79) II. |
rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain. |
| JDW827 |
col-118(wrd343[col-118::mNG::3xFLAG]) IV. |
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-118 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. |
| OC519 |
dpy-10(e128) sds-22(bs9) II. |
Dpy. Reference: Peel N, et al. PLoS Genet. 2017 Jan 19;13(1):e1006543. doi: 10.1371/journal.pgen.1006543. PMID: 28103229. |
