Laboratory Information
| Name | ZM View on WormBase |
|---|---|
| Allele designation | hp |
| Head | Mei Zhen |
| Institution | Samuel Lunenfeld Research Institute, Toronto, Ontario, Canada |
| Address | Mount Sinai hospital Room 870 600 University Ave Toronto M5G 1X5 Canada |
| Website | http://www.mshri.on.ca/zhen |
| Gene classes | fsn sai nlf |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| RG5105 | +/mT1 [umnIs52] II; mrpl-44(gk5627[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. | C. elegans | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4556 and CGC66. gk5627 is a deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5106 | +/mT1 [umnIs52] II; eif-3.D(gk5753[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. | C. elegans | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5753 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4684 and CGC66. gk5753 is a deletion of 2118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGAATACAAGAAATTGTCAGAAACCGGGG. Right flanking sequence: GACGCCACCTCAATTTTTGGTTTTTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| WEN1 | wenIs1. | C. elegans | wenIs1 [acr-5p::Arch::wCherry + lin-15(+)]. RFP expression in B motor neurons. Strain allows optogenetic inactivation of B motor neurons. Reference: Xu T, et al. Proc Natl Acad Sci USA. 2018 May 8;115(19):E4493-E4502. doi: 10.1073/pnas.1717022115. PMID: 29686107. |
| YX9 | lin-15(n675) X; ahIs1. | C. elegans | ahIs1 [myo-3p::NpHR::eCFP + lin-15(+)]. Muscle specific expression of halorhodospin. In the presence of all-trans-retinol, worms are paralyzed upon light stimulation. Weak CFP expression in muscles. Reference: Faoud AD, et al. Elife. 2018 Jan 23:7:e29913. doi: 10.7554/eLife.29913. PMID: 29360037. |
| ZM10040 | hpIs721. | C. elegans | hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC). |
| ZM10113 | twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpIs727. | C. elegans | hpIs727 [rig-3p::zif-1::sl2::RFP + ttx-3p::GFP]. twk-40(bln282) is a CRISPR generated allele of the endogenous twk-40 locus, inserting TagRFP and ZF1 allowing visualization of endogenous protein expression and localization as well as ZIF-1-mediated degradation. hpIs727 provides AVA neuron-specific expression of ZIF-1, leading to depletion of TWK-40 from AVA. Animals have loopy forward and reversal movements compared to twk-40(bln282) alone. |
| ZM10176 | unc-25(e156) III; hpIs593; ljIs131. | C. elegans | hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10281 | hpIs740. | C. elegans | hpIs740 [twk-40(s)p::GCaMP6s::wScarlet + lin-15(+)]. GCaMP and RFP expression in AVA, AVB, AVE and DVA. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10311 | unc-25(e156) III; ljIs131; hpIs758. | C. elegans | ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10339 | hpIs717; ljIs131. | C. elegans | hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10355 | twk-40(bln282[twk-40::TagRFP::ZF1]) III; hpEx4120. | C.elegans | hpEx4120 [rgef-1p::GPI::YFP]. Pick YFP+ animals to maintain. TagRFP::ZF1 tag inserted into endogenous twk-40 locus. |
| ZM10393 | hpIs592; hpIs595. | C. elegans | hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10410 | gbb-2(tm1165) IV; hpIs593; ljIs131. | C. elegans | hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10441 | unc-49(e407) III; hpIs592; ljIs131. | C. elegans | hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10484 | unc-25(e156) III; hpIs321; hpIs331; ljIs131. | C. elegans | hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10538 | hpIs774; hpEx4081. | C. elegans | hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4081 [rig-3p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre + myo-2p::RFP]. Pick RFP+ (pharynx) to maintain. Transgenic animals are GFP and RFP positive in multiple neurons in the head, but strong RFP signals in AVA neurite. Superficially wild type. Activation of gtACR2 decreases AVA and AVB’s calcium signals. hpEx4081 can be maintained by picking animals with weak pharyngeal RFP signals (seems to be a common artifact of the Cre-LoxP system). |
| ZM10743 | unc-49(e407) III; gbb-2(tm1165) IV; hpIs592; ljIs131. | C. elegans | hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10755 | hpIs814. | C. elegans | hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. Slow forward and backward movement, with reduced reversals. |
| ZM10767 | hpIs819. | C. elegans | hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. Cytoplasmic GFP and nuclear RFP in AVA, AVE, AVB and some neurons in RVG, and tail (DVA). |
| ZM10786 | hpIs721; hpIs811. | C. elegans | hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite. |
| ZM1079 | unc-77(hp102) IV. | C. elegans | Hyperactive coiler. hp102 is a gain-of-function mutation. Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069. |
| ZM10806 | hpIs824. | C. elegans | hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement. |
| ZM10823 | hpIs596; hpIs268. | C. elegans | hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782. |
| ZM10829 | hpEx4271. | C. elegans | hpEx4271 [gbb-2(fosmid)::GFP + myo-2p::RFP]. Pick animals with red fluorescence to maintain. GBB-2::GFP expression in muscles and neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM10942 | lin-15B&lin-15A(n765) X; hpIs774; hpEx4292. | C. elegans | hpIs774 [twk-40p(short)::GCaMP6s::mNeptune]. hpEx4292 [pdf-1p::LoxP::eBFP::LoxP::gtACR2::Cherry + twk-40p(short)::Cre + lin-15(+)]. Pick non-Muv to maintain. Red and green fluorescence in multiple head neurons. Activation of gtACR2 reduces AVB signals but does not generate specific changes in AVA. |
| ZM11006 | ljIs131; hpEx4340. | C. elegans | ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701. |
| ZM11020 | ljIs131; hpEx4343. | C. elegans | ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701. |
| ZM11034 | hpIs819; hpIs810. | C. elegans | hpIs819 [twk-40p(short)::GCaMP::T2A::NLS::mNeptune + lin-15(+)]. hpIs810 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Transgenic animals exhibit strong RFP signals in AVA soma and neurites; cytoplasmic GFP and RFP in AVA, AVE, AVB and some neurons in RVG and tail (DVA). |
| ZM11039 | hpEx4351. | C. elegans | hpEx4351 [npr-4p::ins-22::GFP]. Pick animals with green fluorescence in VNC to maintain. Additional GFP expression in coelomocytes. |
| ZM11082 | twk-40(hp834) III; hpIs814. | C. elegans | hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone. |
| ZM11084 | hpEx4363. | C. elegans | hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. |
| ZM11085 | hpIs814; hpEx4363. | C. elegans | hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. hpEx4363 [npr-4p::ins-22::pHluorin + myo-2p::wCherry]. Pick wCherry+ (pharynx) animals to maintain. Red fluorescence in AVA. |
| ZM11086 | hpEx4362. | C. elegans | hpEx4362 [flp-18p::cha-1(sense) + twk-40p::cha-1(antisense) + ttx-3p::GFP]. Pick animals with GFP expression in AIY to maintain. Transgenic animals exhibit reduced forward speed and body bending; this phenotype is not fully penetrate. |
| ZM11151 | hpIs758; hpIs814. | C. elegans | hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40p(short)::Cre + myo-2p::wCherry]. hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. RFP positive in AVA soma and neurite along the VNC. Weak pharyngeal RFP. Flat and slow movement without ATR or LED stimulation. Chrimson activation induces loopy reversal but not loopy forward after 5min. |
| ZM11177 | hpIs860. | C. elegans | hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
| ZM11207 | twk-40(bln336) III; hpIs860. | C. elegans | hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. twk-40 gain-of-function allele. Paralyzed, no backward movement upon head touch. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
| ZM11208 | twk-40(hp834) III; hpIs860. | C. elegans | hpIs860 [twk-40p(short)::eGFP + myo-2p::wCherry]. Loopy movement with increased reversals. Cytosolic GFP expression in AVA, AVE & AVB in the head, with the strongest signal in AVA. Additional fluorescent signal in RVG (SAB) and tail (DVA). |
| ZM11284 | twk-40(bln336) III; hpEx4479. | C. elegans | hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(bln336) is a gain-of-function allele. Paralyzed; no backward movement upon head touch. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with weaker expression than in a wild-type background. |
| ZM11285 | twk-40(hp834) III; hpEx4479. | C. elegans | hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. twk-40(hp834) is a loss-of-function allele. Loopy. Synapse exocytosis marker for AVA. Transgenic animals exhibit punctate fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. |
| ZM11286 | hpIs636; hpEx4479. | C. elegans | hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites. |
| ZM1157 | daf-2(e1370) III; juIs1 IV. | C. elegans | juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. |
| ZM1344 | hpIs61 II. | C. elegans | hpIs61 [unc-25p::unc-10::GFP]. hpIs61 maps to LG II. |
| ZM1385 | hpIs66. | C. elegans | hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49. |
| ZM2246 | hpIs88. | C. elegans | hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49. |
| ZM2960 | nca-2(gk5) III; unc-77(gk9) IV. | C. elegans | Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323. |
| ZM3087 | unc-9(fc16) unc-7(e5) X. | C. elegans | Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. |
| ZM3360 | unc-77(hp102) IV; unc-80(hp369) V. | C. elegans | Fainter. hp369 is an early nonsense mutation in unc-80 and was isolated as a suppressor of unc-77(hp102). Reference: Yeh E, et al. PLoS Biol. 2008 Mar 11;6(3):e55. doi: 10.1371/journal.pbio.0060055. PMID: 18336069. |
| ZM4366 | hpIs157. | C. elegans | hpIs157 [glr-1p::YC3.60 + lin-15(+)]. Strong fluorescent marker for inter-neuron/head motor neuron Ca2+ imaging (FRET). Construct includes 5.3 kb glr-1 genomic promoter sequence upstream of the ATG start codon. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460 |
| ZM4624 | hpIs166. | C. elegans | hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323. |
| ZM4864 | daf-2(e1370) III; oxIs22. | C. elegans | oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. |
| ZM4898 | hpIs171. | C. elegans | hpIs171 [acr-2p::D3cpv + lin-15(+)]. Strong fluorescent marker for motor neuron Ca2+ imaging (FRET). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460 |
| ZM5016 | hpIs178. | C. elegans | hpIs178 [unc-17p::NpHR::GFP + lin-15(+)]. GFP expression in cholinergic neurons. Reference: Leifer AM, et al. Nat Methods. 2011 Feb;8(2):147-52. doi: 10.1038/nmeth.1554. PMID: 21240279. |
| ZM5043 | hpIs190. | C. elegans | hpIs190 [nmr-1p::D3cpv + lin-15(+)]. Strong fluorescent marker for Ca2+ imaging (FRET) AVA, AVE, AVD, RIM and a few other neurons. Construct includes 5.1 kb nmr-1 genomic promoter sequence upstream of the ATG start codon but a excludes a 2 kb fragment encoding cex-1 that interferes with calcium imaging (Kawano and Zhen, unpublished observation). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460 |
| ZM5101 | hpIs193. | C. elegans | hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043 |
| ZM5132 | hpIs179. | C. elegans | hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. |
| ZM54 | hpIs3 X. | C. elegans | hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41. |
| ZM5488 | hpIs202. | C. elegans | hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887. |
| ZM5838 | hpIs223. | C. elegans | hpIs223 [rgef-1p::GFP::FUS + lin-15(+)]. GFP expression in neurons. Essentially wild-type movement; slight difference compared to N2 animals. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393. |
| ZM5842 | hpIs228. | C. elegans | hpIs228 [rgef-1p::GFP::FUS[R522G] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393. |
| ZM5844 | hpIs233. | C. elegans | hpIs233 [rgef-1p::GFP::FUS[P525L] + lin-15(+)]. GFP expression in neurons. Slow motor activity compared to animals expressing wild-type GFP::FUS under the same promoter. C. elegans model for FUS ALS gene mutation. Reference: Murakami T, et al. Neuron. 2015 Nov 18;88(4):678-90. doi: 10.1016/j.neuron.2015.10.030. PMID: 26526393. |
| ZM588 | fsn-1(hp1) III; juIs1 IV; scd-2(ok565) V. | C. elegans | juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults. |
| ZM607 | syd-2(ok217) X. | C. elegans | Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA). |
| ZM6523 | hpDf761 II; unc-119(ed3) III. | C. elegans | hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. |
| ZM6539 | unc-39(hp701) V. | C. elegans | Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782 |
| ZM6610 | nlf-1(hp428) X. | C. elegans | Fainter. hp428 is a G to A substitution that alters the 3′ splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043. |
| ZM6660 | got-1.2(hp731) X. | C. elegans | got-1.2(hp731) is C184Y substitution mutation. Reference: Chitturi J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. PMID: 29649217. |
| ZM6665 | hpIs268. | C. elegans | hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Strain allows calcium imaging for D-motor neurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782. |
| ZM6686 | hpIs289. | C. elegans | hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043. |
| ZM6725 | hpIs290. | C. elegans | hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043. |
| ZM6804 | hpIs270. | C. elegans | hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035 |
| ZM7054 | hpIs321. | C. elegans | hpIs321 [nmr-1p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neurons ablation (AVA/AVE/AVD/others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035 |
| ZM7055 | hpEx2999. | C. elegans | hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919 |
| ZM7212 | unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088. | C. elegans | hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323. |
| ZM7297 | hpIs331. | C. elegans | hpIs331 [lgc55Bp::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation (AVB & others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035 |
| ZM7419 | hpIs363. | C. elegans | hpIs363 [sra-11p::ChR2::YFP + ttx-3p::RFP]. YFP expression in AVA. RFP expression in AIY. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM7465 | hpIs321; hpIs331; ljIs131. | C. elegans | hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM7646 | unc-77(gk9); nca-2(gk5); hpIs166; hpEx3197. | C. elegans | hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323. |
| ZM7648 | unc-77(gk9); nca-2(gk5); hpIs166; hpEx3195. | C. elegans | hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323. |
| ZM7656 | hpIs365. | C. elegans | hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM7691 | hpIs371. | C. elegans | hpIs371 [unc-4p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation marker for A-class (A-MNs) and other motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035 |
| ZM7696 | hpIs376. | C. elegans | hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. |
| ZM7765 | unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. | C. elegans | hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323. |
| ZM7798 | hpIs372. | C. elegans | hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. |
| ZM7963 | hpDf761 II; daf-28(tm2308) V. | C. elegans | Temperature-sensitive Daf-c. Maintain at 15C. hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. Development. 2014 Apr;141(8):1767-79. |
| ZM7978 | hpIs327. | C.elegans | hpIs327 [cex-1p::tomm-20::miniSOG::sl2::Cherry]. Maintain in darkness. miniSOG and Cherry expression in RIM. |
| ZM8202 | ubr-1(hp821 hp833) I. | C. elegans | Stiff backing. Presumptive null. This strain carries two CRISPR-engineered deletions to ensure complete knockout of ubr-1 function. hp821 is a deletion in the 5 ' end of ubr-1 and hp833 is a deletion near the 3' end of the gene. Reference: Chiturri J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. eCollection 2018 Apr. PMID: 29649217. |
| ZM8302 | twk-40(hp834) III. | C. elegans | Loss-of-function allele. Loopy movement with increased reversals. |
| ZM8428 | hpIs459. | C. elegans | hpIs459 [unc-4p::GCaMP3::wCherry + lin-15(+)]. Strong GCaMP3 and wCherry expression in A-class motor neurons, as well as some head and tail neurons. It is recommended to use L4 stage animals when using this strain for calcium imaging and recording. Transgene expression becomes dimmer in many A-class neurons (except DA9), and is expression in VC neurons of adults. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035 |
| ZM8561 | daf-2(m596) III; hpEx2906. | C. elegans | hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79. |
| ZM8562 | daf-2(m596) III; hpEx3369. | C. elegans | hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79. |
| ZM8607 | hpIs481. | C. elegans | hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. |
| ZM8614 | hpIs372; hpIs365. | C. elegans | hpIs372 [acr-5p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM8615 | hpIs371; hpIs365. | C. elegans | hpIs371 [unc-4p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM8874 | daf-16(mu86) I; daf-2(e1370) III; hpEx3371. | C. elegans | hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779. |
| ZM8958 | hpIs569. | C. elegans | hpIs569 [unc-4::Chrimson::wCherry + lin-15(+)]. Marker for optogenetic stimulation in A-class (A-MNs) and other motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035 |
| ZM8969 | flp-14(gk1055) III. | C.elegans | Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782 |
| ZM8988 | daf-2(m596) III; hpEx2908. | C. elegans | hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79. |
| ZM9027 | hpIs578. | C. elegans | hpIs578 [ceh-12p::Chrimson::wCherry + lin-15(+)]. Marker for optogenetic stimulation in VB motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035 |
| ZM9028 | daf-2(m596) III; hpEx2905. | C. elegans | hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79. |
| ZM9040 | unc-2(hp647) X. | C. elegans | Hyperactive. Frequent alternation between forward and backward locomotion (shuttling). hp647 is a is a gain-of-function mutation identified as a suppressor of the 'fainter' motor defects of unc-80(e1069) mutants. Reference: Gao S, Elife. 2018 Jan 23:7:e29915. doi: 10.7554/eLife.29915. PMID: 29360035. |
| ZM9062 | hpIs583. | C. elegans | hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. |
| ZM9078 | hpIs587. | C. elegans | hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887. |
| ZM9123 | hpIs590. | C. elegans | hpIs590 [ttr-39p::tomm20::miniSOG::SL2::BFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915. |
| ZM9128 | hpIs595. | C. elegans | hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9140 | hpIs600. | C. elegans | hpIs600 [myo-3p::GCaMP6::wCherry + lin-15(+)]. GFP and RFP in body wall muscles. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701. |
| ZM9172 | unc-25(e156) III; ljIs131. | C. elegans | ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9176 | hpIs603. | C. elegans | hpIs603 [lgc-55Bp::tomm20::miniSOG::SL2::BFP + nmr-1p::tomm20::miniSOG::SL2::BFP + acr-5p::tomm20-miniSOG-SL2::BFP + lin-15(+)]. MiniSOG neuron ablation of all premotor interneurons, B-class motor neurons (B-MN), and other neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035 |
| ZM9313 | hpIs625; ljIs131. | C. elegans | hpIs625 [ttr-39p::Arch::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9354 | hpIs636. | C. elegans | hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity. |
| ZM9429 | zxIs6; ljIs131. | C. elegans | zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Body contracts and coils dorsally upon blue light illumination on ATR plates. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9441 | daf-16(mu86) I; daf-2(e1370) III; hpEx3370. | C. elegans | hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779. |
| ZM9442 | daf-16(mu86) I; daf-2(e1370) III; hpEx3373. | C. elegans | hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779. |
| ZM9443 | daf-16(mu86) I; daf-2(e1370) III; hpEx3507. | C. elegans | hpEx3507 [ges-1p::GFP::daf-16d/f::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779. |
| ZM9444 | daf-16(mu86) I; daf-2(e1370) III; hpEx3508. | C. elegans | hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779. |
| ZM9474 | flp-14(gk1055) III; hpSi38. | C elegans | hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782 |
| ZM9519 | flp-14(gk1055) III; hpSi38; hpIs201. | C. elegans | hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782 |
| ZM9551 | hpIs593; ljIs131. | C. elegans | hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neuron activation and muscle relaxation upon illumination with green light. Muscle activity measured by GCaMP3. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9573 | unc-25(e156) III; zxIs6; ljIs131. | C. elegans | zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Cholinergic activation. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9583 | unc-2(hp858) X. | C. elegans | GFP tag inserted at the N-terminus (immediately in front of the ATG start codon) of the unc-2 locus specifically tagging the UNC-2B isoform. hp858 animals exhibit wildtype motor behaviors. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035 |
| ZM9585 | hpIs615; hpIs365. | C. elegans | hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9648 | hpIs673; ljIs131. | C. elegans | hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
| ZM9660 | unc-25(e156) III; hpIs673; ljIs131. | C. elegans | hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press). |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| hp1 | Allele | substitution |