Laboratory Information

NameZM View on WormBase
Allele designationhp
HeadMei Zhen
InstitutionSamuel Lunenfeld Res Inst, Toronto, Ontario, Canada
Address Mount Sinai hospital
Room 870
600 University Ave
Toronto M5G 1X5
Canada
Website http://www.mshri.on.ca/zhen
Gene classes fsn  sai  nlf 

Strains contributed by this laboratory

Strain Genotype Species Description
ZM10176 unc-25(e156) III; hpIs593; ljIs131. C. elegans hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10206 hpEx4080 [Prig-3-LoxP::EBFP::LoxP::Chrimson::wCherry + Ptwk-40s-Cre + Pmyo-2-wCherry] C. elegans go back when active, weak myo-2 mcherry. Weak AVA cherry signals
ZM10281 hpIs740 [Ptwk-40s-GCaMP6s::wScarlet+lin-15(+)] C. elegans GCaMP and RFP in AVA, AVB, AVE and DVA
ZM10311 unc-25(e156); hpEx4080 [Prig-3-LoxP::EBFP::LoxP::Chrimson::wCherry + Ptwk-40s-Cre + Pmyo-2-wCherry]; ljIs131[Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1. Shrinker (unc-25);2. Reversal upon green light illumination on ATR; RFP in AVA and a few other
ZM10339 hpIs717 [Pacr-2s-LoxP::EBFP::LoxP::Chrimson::wCherry + Punc-17-Cre + lin-15(+)]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans wildtype with RFP marker in mortor neurons
ZM10393 hpIs592 [Pttr-39-Chrimson::wCherry + lin-15(+)]; hpIs595 [Pacr-2s-GCaMP6s::wCherry + lin-15(+)] C. elegans 1. Body relaxation upon green light illumination on ATR (hpIs592); 2. A and B motor neurons calcium imaging (hpIs595)
ZM10410 gbb-2(tm1165) IV; hpIs593; ljIs131. C. elegans hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. D motor neurons are marked with red fluorescence. Body relaxation upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10441 unc-49(e407); hpIs592 [Pttr-39-Chrimson::wCherry + lin-15(+)]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1. Shringker (unc049 (e407)); 2. A bit for body relaxeation upon green light illumination (hpIs592)
ZM10458 hpEx4134 [Pacr-2s-LoxP::EBFP::LoxP::GtACR2::wCherry + Punc-17-Cre]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1. Body relaxation upon blue light illumination; 2. RFP in A and B motor neurons, as well as pharynx (probably because loxP or loxP-EBFP-loxP sequence can act as a promotor in pharynx); 3. Muscle calcium immaging (ljIs131)
ZM10484 unc-25(e156); hpIs321 [Pnmr-1-miniSOG::UrSL2::wCherry + lin-15(+)]; hpIs331 [Plgc55-miniSOG::UrSL2::wCherry + lin-15(+)]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1.Shrinker (unc-25(e156);2.After 1hr blue light illumination, dorsal-coiler in L1, kinker in Adult (hpIs321)
ZM10552 hpEx4081 [Prig-3-LoxP::EBFP::LoxP::GtACR2::wCherry + Ptwk-40s-Cre + lin-15(+)]; hpIs733 [Psra-11-LoxP::EBFP::LoxP::GtACR2::wCherry + Ptwk-40s-Cre + lin-15(+)]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1. AVA, AVB, pharyngeal and hind gut RFP; 2. stops moving unon blue light illumination on ATR (hpEx4081)
ZM10575 hpEx4171 [Punc-17-GtACR2::wCherry]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1. RFP in cholinergic neruons; body relaxation upon blue light illumination on ATR )hpEx4171)
ZM10579 hpEx4176 [Prgef-1-GtACR2::wCherry]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1. All neurons RFP; body relaxation upon blue light illumination (hpEx4176); 2. Muscle calcium imaging (ljIs131)
ZM10673 gbb-2(tm1165); hpIs592 [Pttr-39-Chrimson::wCherry + lin-15(+); hpIs595 [Pacr-2s-GCaMP6s::wCherry + lin-15(+)] C. elegans RFP and GFP in A and B. Very weak RFP in D
ZM10743 unc-49(e407); gbb-2(tm1165); hpIs592 [Pttr-39-Chrimson::wCherry + lin-15(+)]; ljIs131[Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans 1. Shringker (unc-49 (e407); 2. RFP in D-type motor neurons (hpIs592)
ZM10823 hpIs596 [Pacr-2s-Chrimson::wCherry + lin-15(+)]; hpIs268[Punc-25-GCaMP3::UrSL2::wCherry + lin-15(+)] C. elegans GFP and RFP in D motorneurons. Very weak RFP in A and B motorneurons. Appear unc. (unc is liked with hpIs596 homozygotes)
ZM10829 hpEx4271 [GBB-2::GFP (fosmid) + Pmyo-2::RFP ] C. elegans RFP in pharynx for transgenic animals/GFP in muscles and neurons
ZM10926 hpIs827 [GBB-1::GFP (fosmid) + Pmyo-2::RFP] C. elegans RFP in pharynx. GFP in nerve ring and ventral nerve cord. Some somas along the vertral cord are also labelled by GFP. Tendency to go sterile ever at 15C
ZM11006 hpEx4340 [Pnmr-1-TeTx::wCherry+ Psra-11-TeTx::wCherry + HygromycinR]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans Use 10ul hygromycine for selection for transgenic. Transgenic animals are severe unc. Check in old animals, RFP positive head neuron soma can be observed under V16
ZM11020 hpEx4343 [Pacr-5-TeTx::wCherry + Punc-4-TeTx::wCherry + HygromycinR]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans transgenic hpEx4343 animals turn to rest as coilers strongly biased towards ventral bend in L1s. Svere unc in adults too. In ljIs131 background this coiling is somewhat suppressed but they still exhibit an obvious bias towards ventral bend during movement
ZM11253 hpEx4455 [Prab-3-cha-1 sense; Pnmr-1-cha-1 anti-sense; Ptwk-40-cha-1 anti-sense + Pmyo-2-RFP]; ljIs131 [Pmyo-3-GCaMP::UrSL2::tagRFP-T] C. elegans unc, not full penetrate
ZM1157 daf-2(e1370) III; juIs1 IV. C. elegans juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM1344 hpIs61 II. C. elegans hpIs61 [unc-25p::unc-10::GFP]. hpIs61 maps to LG II.
ZM1385 hpIs66. C. elegans hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM2246 hpIs88. C. elegans hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM2960 nca-2(gk5) III; unc-77(gk9) IV. C. elegans Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.
ZM3087 unc-9(fc16) unc-7(e5) X. C. elegans Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM4366 hpIs157. C. elegans hpIs157 [glr-1p::YC3.60 + lin-15(+)]. Strong fluorescent marker for inter-neuron/head motor neuron Ca2+ imaging (FRET). Construct includes 5.3 kb glr-1 genomic promoter sequence upstream of the ATG start codon. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460
ZM4624 hpIs166. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.
ZM4864 daf-2(e1370) III; oxIs22. C. elegans oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM4898 hpIs171. C. elegans hpIs171 [acr-2p::D3cpv + lin-15(+)]. Strong fluorescent marker for motor neuron Ca2+ imaging (FRET). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460
ZM5043 hpIs190. C. elegans hpIs190 [nmr-1p::D3cpv + lin-15(+)]. Strong fluorescent marker for Ca2+ imaging (FRET) AVA, AVE, AVD, RIM and a few other neurons. Construct includes 5.1 kb nmr-1 genomic promoter sequence upstream of the ATG start codon but a excludes a 2 kb fragment encoding cex-1 that interferes with calcium imaging (Kawano and Zhen, unpublished observation). Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86. PMID: 22099460
ZM5101 hpIs193. C. elegans hpIs193 [nlf-1p::nlf-1::GFP + lin-15(+)]. GFP expression in head and tail neurons, as well as along ventral cord. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043
ZM5132 hpIs179. C. elegans hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM54 hpIs3 X. C. elegans hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.
ZM5488 hpIs202. C. elegans hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM588 fsn-1(hp1) III; juIs1 IV; scd-2(ok565) V. C. elegans juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.
ZM607 syd-2(ok217) X. C. elegans Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
ZM6523 hpDf761 II; unc-119(ed3) III. C. elegans hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM6539 unc-39(hp701) V. C. elegans Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM6634 hpEx2814 [GFP::EGL-19; pgcy-32::cherry] C.elegans Does array have a name in de Bono lab? Should not be renamed if so. hpEx2814 [GFP::egl-19 + pgcy-32::mCherry]. Maintain by picking mCherry+ animals. GFP::EGL-19 expression in neurons and muscles. Derived by outcrossing parental strain EN2411 to N2 to remove npr-1 mutation. Reference: Arellano-Carbajal F, et al. Neuron. 2013 Mar 20;77(6):1069-82.
ZM6665 hpIs268. C. elegans hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Strain allows calcium imaging for D-motor neurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
ZM6686 hpIs289. C. elegans hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6725 hpIs290. C. elegans hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6804 hpIs270. C. elegans hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
ZM7054 hpIs321. C. elegans hpIs321 [nmr-1p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neurons ablation (AVA/AVE/AVD/others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM7055 hpEx2999. C. elegans hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919
ZM7212 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7297 hpIs331. C. elegans hpIs331 [lgc55Bp::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation (AVB & others). Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM7419 hpIs363 [Psra-11-ChR2::YFP + Pttx-3::RFP] C. elegans YFP is expressed in AVA and RFP can be seen in AIY neurons (marker)
ZM7465 hpIs321 [Pnmr-1-miniSOG::UrSL2::wCherry + lin-15(+)]; hpIs331 [Plgc55-miniSOG::UrSL2::wCherry + lin-15(+)]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans wildtype with RFP marker in inter-neurons
ZM7646 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3197. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7648 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3195. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7656 hpIs365 [Punc-25-GCaMP3::wCherry + lin-15(+)] C. elegans wildtype with RFP marker in mortor neurons
ZM7691 hpIs371. C. elegans hpIs371 [unc-4p::tomm20::miniSOG::SL2::RFP + lin-15(+)]. MiniSOG neuron ablation marker for A-class (A-MNs) and other motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM7696 hpIs376. C. elegans hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM7765 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7798 hpIs372. C. elegans hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM7963 hpDf761 II; daf-28(tm2308) V. C. elegans Temperature-sensitive Daf-c. Maintain at 15C. hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. Development. 2014 Apr;141(8):1767-79.
ZM8428 hpIs459. C. elegans hpIs459 [unc-4p::GCaMP3::wCherry + lin-15(+)]. Strong GCaMP3 and wCherry expression in A-class motor neurons, as well as some head and tail neurons. It is recommended to use L4 stage animals when using this strain for calcium imaging and recording. Transgene expression becomes dimmer in many A-class neurons (except DA9), and is expression in VC neurons of adults. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
ZM8561 daf-2(m596) III; hpEx2906. C. elegans hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8562 daf-2(m596) III; hpEx3369. C. elegans hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8607 hpIs481. C. elegans hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM8614 hpIs372 [Pacr-5-miniSOG::SL2::wCherry + lin-15(+)]; hpIs365[Punc-25-GCaMP3::wCherry + lin-15(+)] C. elegans wildtype with RFP marker in mortor neurons
ZM8615 hpIs371 [Punc-4-miniSOG::SL2::wCherry + lin-15(+)]; hpIs365[Punc-25-GCaMP3::wCherry + lin-15(+)] C. elegans wildtype with RFP marker in mortor neurons
ZM8874 daf-16(mu86) I; daf-2(e1370) III; hpEx3371. C. elegans hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM8958 hpIs569. C. elegans hpIs569 [unc-4::Chrimson::wCherry + lin-15(+)]. Marker for optogenetic stimulation in A-class (A-MNs) and other motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM8969 flp-14(gk1055) III. C.elegans Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM8988 daf-2(m596) III; hpEx2908. C. elegans hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9027 hpIs578. C. elegans hpIs578 [ceh-12p::Chrimson::wCherry + lin-15(+)]. Marker for optogenetic stimulation in VB motor neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM9028 daf-2(m596) III; hpEx2905. C. elegans hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9062 hpIs583. C. elegans hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9078 hpIs587. C. elegans hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM9123 hpIs590. C. elegans hpIs590 [ttr-39p::tomm20::miniSOG::SL2::BFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9128 hpIs595 [Pacr-2s-GCaMP6s::wCherry + lin-15(+)] C. elegans wildtype with RFP marker in mortor neurons
ZM9172 unc-25(e156) III; ljIs131. C. elegans ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM9176 hpIs603. C. elegans hpIs603 [lgc-55Bp::tomm20::miniSOG::SL2::BFP + nmr-1p::tomm20::miniSOG::SL2::BFP + acr-5p::tomm20-miniSOG-SL2::BFP + lin-15(+)]. MiniSOG neuron ablation of all premotor interneurons, B-class motor neurons (B-MN), and other neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM9313 hpIs625 [Pttr-39-Arch::wCherry + lin-15(+)]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans wildtype
ZM9429 zxIs6; ljIs131. C. elegans zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Body contracts and coils dorsally upon blue light illumination on ATR plates. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM9441 daf-16(mu86) I; daf-2(e1370) III; hpEx3370. C. elegans hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9442 daf-16(mu86) I; daf-2(e1370) III; hpEx3373. C. elegans hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9443 daf-16(mu86) I; daf-2(e1370) III; hpEx3507. C. elegans hpEx3507 [ges-1p::GFP::daf-16d/f::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9444 daf-16(mu86) I; daf-2(e1370) III; hpEx3508. C. elegans hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9474 flp-14(gk1055) III; hpSi38. C elegans hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9519 flp-14(gk1055) III; hpSi38; hpIs201. C. elegans hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9551 hpIs593 [Pttr-39-Chrimson::wCherry + lin-15(+)]; ljIs131 [Pmyo-3-GCaMP3::UrSL2::tagRFP-T] C. elegans D motor neurons activation and muscle relaxation upon green light illumination. Muscle activity respresented by GCaMP3
ZM9573 unc-25(e156) III; zxIs6; ljIs131. C. elegans zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Cholinergic activation. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM9583 unc-2(hp858) X. C. elegans GFP tag inserted at the N-terminus (immediately in front of the ATG start codon) of the unc-2 locus specifically tagging the UNC-2B isoform. hp858 animals exhibit wildtype motor behaviors. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZM9585 hpIs615 [Pacr-2s-Arch::wCherry + lin-15(+)]; hpIs365[Punc-25-GCaMP3::wCherry + lin-15(+)] C. elegans A and B motor neurons inhibited and bdy relaxed upon green light illumination. D motor meurons (plus other GABAergic neurons) calcium response.
ZM9648 hpIs673; ljIs131. C. elegans hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM9660 unc-25(e156) III; hpIs673; ljIs131. C. elegans hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
hp1 Allele substitution