Laboratory Information

NameZM View on WormBase
Allele designationhp
HeadMei Zhen
InstitutionSamuel Lunenfeld Res Inst, Toronto, Ontario, Canada
Address Mount Sinai hospital
Room 870
600 University Ave
Toronto M5G 1X5
Canada
Website http://www.mshri.on.ca/zhen
Gene classes fsn  sai  nlf 

Strains contributed by this laboratory

Strain Genotype Species Description
ZM1157 daf-2(e1370) III; juIs1 IV. C. elegans juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM1344 hpIs61 II. C. elegans hpIs61 [unc-25p::unc-10::GFP]. hpIs61 maps to LG II.
ZM1385 hpIs66. C. elegans hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM2246 hpIs88. C. elegans hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
ZM2960 nca-2(gk5) III; unc-77(gk9) IV. C. elegans Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.
ZM3087 unc-9(fc16) unc-7(e5) X. C. elegans Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM4624 hpIs166. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. Reference: Gao S, et al. 2015. Nature Communications 6, Article number: 6323.
ZM4864 daf-2(e1370) III; oxIs22. C. elegans oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM5132 hpIs179. C. elegans hpIs179 [sra-11p::D3cpv]. 2.8 kb sra-11 promoter sequence drives Cameleon (a genetically-induced calcium indicator) in AVB, AIA, and AIY head interneurons. Reference: Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM54 hpIs3 X. C. elegans hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.
ZM5488 hpIs202. C. elegans hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM588 fsn-1(hp1) III; juIs1 IV; scd-2(ok565) V. C. elegans juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.
ZM607 syd-2(ok217) X. C. elegans Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
ZM6523 hpDf761 II; unc-119(ed3) III. C. elegans hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM6634 hpEx2814 [GFP::EGL-19; pgcy-32::cherry] C.elegans Does array have a name in de Bono lab? Should not be renamed if so. hpEx2814 [GFP::egl-19 + pgcy-32::mCherry]. Maintain by picking mCherry+ animals. GFP::EGL-19 expression in neurons and muscles. Derived by outcrossing parental strain EN2411 to N2 to remove npr-1 mutation. Reference: Arellano-Carbajal F, et al. Neuron. 2013 Mar 20;77(6):1069-82.
ZM6686 hpIs289. C. elegans hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6725 hpIs290. C. elegans hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
ZM6804 hpIs270. C. elegans hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
ZM7055 hpEx2999. C. elegans hpEx2999 [ins-4::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP-tagged INS-4::GFP expression driven by its own promoter and UTR. GFP expression in ASI, ASJ, some motor neurons, and punctate expression along dorsal cord as well. Generated in N2 background. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60. PMID: 23665919
ZM7212 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3088. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3088 [rgef-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7646 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3197. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3197 [sto-6p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in cholinergic neurons to maintain. Body curvature becomes deeper in some transgenic animals. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7648 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3195. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7696 hpIs376. C. elegans hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM7765 unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. C. elegans hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7798 hpIs372. C. elegans hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM7963 hpDf761 II; daf-28(tm2308) V. C. elegans Temperature-sensitive Daf-c. Maintain at 15C. hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. Development. 2014 Apr;141(8):1767-79.
ZM8428 hpIs459. C. elegans hpIs459 [unc-4p::GCaMP3::wCherry + lin-15(+)]. Strong GCaMP3 and wCherry expression in A-class motor neurons, as well as some head and tail neurons. It is recommended to use L4 stage animals when using this strain for calcium imaging and recording. Transgene expression becomes dimmer in many A-class neurons (except DA9), and is expression in VC neurons of adults. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
ZM8561 daf-2(m596) III; hpEx2906. C. elegans hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8562 daf-2(m596) III; hpEx3369. C. elegans hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8607 hpIs481. C. elegans hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM8874 daf-16(mu86) I; daf-2(e1370) III; hpEx3371. C. elegans hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM8988 daf-2(m596) III; hpEx2908. C. elegans hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9028 daf-2(m596) III; hpEx2905. C. elegans hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9062 hpIs583. C. elegans hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9078 hpIs587. C. elegans hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
ZM9123 hpIs590. C. elegans hpIs590 [ttr-39p::tomm20::miniSOG::SL2::BFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9441 daf-16(mu86) I; daf-2(e1370) III; hpEx3370. C. elegans hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9442 daf-16(mu86) I; daf-2(e1370) III; hpEx3373. C. elegans hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9443 daf-16(mu86) I; daf-2(e1370) III; hpEx3507. C. elegans hpEx3507 [ges-1p::GFP::daf-16d/f::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9444 daf-16(mu86) I; daf-2(e1370) III; hpEx3508. C. elegans hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
hp1 Allele substitution