Laboratory Information
| Name | UP View on WormBase |
|---|---|
| Allele designation | cs |
| Head | Meera Vedavalli Sundaram |
| Institution | University of Pennsylvania, Philadelphia, PA |
| Address | 445 Clinical Research Building Dept of Genetics, Perelman School of Medicine 415 Curie Blvd Philadelphia 19104-6145 United States |
| Website | http://www.med.upenn.edu/camb/faculty/ggr/sundaram.html |
| Gene classes | ave cnk ekl eor lpr lron |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| HP17 | sos-1(pd10) V. | C. elegans | sos-1 gain-of-function allele originally isolated as a suppressor of sem-5(n1619) lethality. pd10 causes a E99K substitution within the N-terminal histone fold domain of SOS-1. Single mutants appear wild-type. |
| HP23 | sos-1(pd9) V. | C. elegans | sos-1(pd9) is a gain-of-function allele causing a C662Y substitution within the Ras exchange motif of SOS-1. Originally isolated as a suppressor of sem-5(n1619) lethality. Single mutants appear wild-type. Reference: Wooller A & Hopper N. (2014) European Worm Meeting. (Anyone using this allele may cite Neil Hopper as a personal communication based on this meeting abstract.) |
| MH575 | lin-45(ku51) dpy-20(e1282) IV. | C. elegans | Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal. |
| MH620 | lin-45(ku112) dpy-20(e1282) IV. | C. elegans | Weak hypomorphic allele of lin-45. Animals are Dpy but otherwise appear normal. Occasional larval lethality. |
| PHX3685 | dpy-17(syb3685[dpy-17::mNG]) III. | C. elegans | mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| PHX3691 | sqt-3(syb3691[sqt-3::mNG(int)]) V. | C. elegans | mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| PHX5321 | bli-4(syb5321[bli-4::SfGFP(int)]) I. | C. elegans | bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| UP1135 | csEx52. | C. elegans | csEx52[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+. |
| UP1136 | csEx53. | C. elegans | csEx53[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+. |
| UP1153 | csEx63. | C. elegans | csEx63 [(pMS88) hsp16-41::torso^4021-Draf + (pTG96) sur-5::GFP]. Pick GFP+ to maintain. Muv phenotype in GFP+ after heat shock during larval stage. References: Kao G, et al. Development. 2004 Feb;131(4):755-65. Rocheleau CE, et al. Proc Natl Acad Sci U S A. 2005 Aug 16;102(33):11757-62. |
| UP1226 | csEx72. | C. elegans | csEx72[hsp::lin-45ED + sur-5::GFP]. Maintain by picking GFP+. |
| UP1321 | lpr-1(cs73) I. | C. elegans | Most animals die as rod-like lethal L1 larvae. Grow at 20C. |
| UP148 | sem-5(cs15) X. | C. elegans | Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background. |
| UP233 | eor-1(cs28) IV. | C. elegans | Deletion allele. Mildly Unc, low percentage larval lethal, low percentage Egl. |
| UP2436 | lpr-1(cs207) I. | C. elegans | cs207 is an early nonsense allele (Q72stop). Approximately 90% rod-like larval lethal, with 10% normal escapers. Exact percentages are sensitive to temperature and culture conditions. |
| UP2813 | csSi3 [lin-3::lin-3S + unc-119(+)] II; lin-3(n1059) IV/nT1[qIs51] (IV;V) | C. elegans | lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3S (short) splice isoform, expressed under control of the lin-3 promoter. The transgene rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain. |
| UP2814 | csSi1 [lin-3::lin-3L + unc-119(+)] II; lin-3(n1059) IV/nT1[qIs51] (IV;V) | C. elegans | lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3L (long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain. |
| UP2815 | csSi2 [lin-3::lin-3XL + unc-119(+)] II; lin-3(n1059) IV/nT1[qIs51] (IV;V) | C. elegans | lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3XL (extra long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethality (but not Vulvaless or sterile phenotypes) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain. |
| UP3542 | lpr-3(cs231) X; csEx436. | C. elegans | csEx436 [lpr-3 (fosmid WRM619dE09) + myo-2p::mCherry]. Pick mCherry+ animals to maintain. cs231 is a Crispr/Cas9-induced null allele of lpr-3: a 13 nucleotide deletion in exon 1 results in frameshift. Homozygous mutants are embryonic lethal, but are rescued by csEx436 containing lpr-3(+) fosmid WRM619dE09. NOTE: lpr-3(cs231) should be considered the canonical allele as ok2351 also perturbs expression of adjacent gene lpr-6. Reference: Forman-Rubinsky R, Cohen JD and Sundaram MV. Genetics. 2017 Oct;207(2):625-642. |
| UP3666 | lpr-3(cs250[ssSfGFP::lpr-3]) X. | C. elegans | Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517. |
| UP3746 | let-653(cs262[let-653::SfGFP]) IV. | C. elegans | Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517. |
| UP3756 | let-4(cs265[ssmCherry::let-4]) X. | C. elegans | Endogenous let-4 locus tagged with mCherry using CRISPR/Cas9. mCherry expression is faint. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517. |
| UP4013 | bli-4(cs281) I; csEx919. | C. elegans | csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936. |
| UP533 | eor-2(cs42) X. | C. elegans | Nonsense allele. Mildly Unc, low percentage larval lethal, low percentage Egl. |
| UP604 | sos-1(cs41) V. | C. elegans | Temperature sensitive missense allele. Larval lethal and Vul at 25C. About WT at 20C. Previously called let-341. |
| UP63 | mat-3(ku233) III. | C. elegans | Weak hypomorphic allele. Cold-sensitive. Egl, Pvul and sterile at 20C. |
| UP725 | mat-3(cs53)/unc-45(e286) III. | C. elegans | Heterozygotes are WT and segregate WT, Uncs, and Pvul which are sterile. |
| UP994 | sur-6(sv30) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C. elegans | sur-6(sv30) homozygotes are viable but segregate 100% dead embryos, and are GFP-. Weak Vulvaless and Unc. Maintain strain by picking GFP+ heterozygotes. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. |
| XW18042 | qxIs722 II. | C. elegans | qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. |
| XW5399 | unc-76(e911) V; qxIs257. | C. elegans | qxIs257 [ced-1p::nuc-1::mCherry + unc-76(+)]. Integrated nuc-1::mCherry transgene marking lysosomes in epidermal cells. Site of chromosomal integration unknown. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185. |
| XW8056 | unc-76(e911) V; qxIs430. | C. elegans | qxIs430 [scav-3::GFP + unc-76(+)]. Integrated GFP translational fusion transgene marking lysosomes in epithelial cells. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| cs73 | Allele | substitution | |
| cs15 | Allele | substitution | nonsense |
| cs28 | Allele | deletion | |
| cs42 | Allele | substitution | nonsense |
| cs41 | Allele | substitution | |
| cs53 | Allele | substitution | nonsense |