Laboratory Information

NameRM View on WormBase
Allele designationmd
HeadRand, Jim
InstitutionOklahoma Center for Neuroscience
Address Univ. of Oklahoma Health Sciences Center
Oklahoma City 73072
United States
Gene classes amx  cho  chtl  dat  gbf  glit  gta  lan  lar  nlg  nrx  ric  snf  snt 
tcf 

Strains contributed by this laboratory

Strain Genotype Species Description
CD184 ace-3(dc2) unc-52(e444) II. C. elegans Acetylcholine abnormal. Unc (phenotype exactly like unc-52 except lacking class C acetylcholinesterase).
PR1300 ace-3(dc2) II. C. elegans Completely deficient in Class C acetylcholinesterase activity. Behavior is completely normal.
RM 2005 unc-75(md1344) I C. elegans Small, coily Unc; aldicarb resistant. 780-bp deletion TTCGGTTCGTGTTTTTTATTGATATTTTTT / Δ780 /ACAACATCCATTCGTCACAAGCTGCTATCA
RM1610 snt-1(md184) II. C. elegans snt-1(md184) is a 2400-bp deletion removing exons 3-4. Breakpoints: actatgattgtgattaagcttttttcgatg / / tagaaacgaatcagttcagttgaaaatcta. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305.
RM1613 snt-1(md290) II. C. elegans snt-1(md290) is a 3264-bp deletion removing all coding sequence in exons 3-8. Breakpoints: ttatagatttcaattaaatagtaaacaaaa / / aatctctctttgttttcactcttccaacat. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305.
RM1620 snt-1(md220) II. C. elegans snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.
RM1625 snt-1(md259) II. C. elegans snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.
RM1676 unc-41(md134) V. C. elegans unc-41(md134) is a 5.9-kb deletion that forms an in-frame splice site in the middle of an exon allowing protein production.
RM1677 unc-41(md152) V. C. elegans unc-41(md152) is a 1 bp deletion after amino acid 872 in exon 8 producing GLHKS*. wt sequence: GCTAACTCTTGTGCAGCCCG. md152 sequence: GCTAACTCTTGTGCAGCCCA.
RM1702 ric-8(md303) IV. C. elegans Ric, Egl, severely locomotion defective, reduced body flexion/straight posture, pharyngeal pumping and growth rate slightly lower than WT. Does not reproduce at 25C. Brood size about 1/10 of WT at 20C, and about 1/3 of WT at 14C. 29% of eggs do not hatch. Early embryogenesis defects include misalignment of mitotic spindles and delayed migration of nuclei. Grows best at 14C but you can still work with it and do crosses at 20C.
RM1743 cha-1(md39) cho-1(tm373) IV. C. elegans Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, lethal. References: Rand JB. Genetics. 1989 May;122(1):73-80. Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM1845 cat-1(e1111) X. C. elegans Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes.
RM2005 unc-75(md1344) I. C. elegans Small, coily Unc; aldicarb resistant. 780-bp deletion: TTCGGTTCGTGTTTTTTATTGATATTTTTT /-----/ACAACATCCATTCGTCACAAGCTGCTATCA. Reference: Loria PM, et al., Curr Biol. 2003 Aug 5;13(15):1317-23.
RM2037 unc-17(e245) cho-1(tm373) IV. C. elegans Loosely-linked (~12 cM apart) cholinergic mutants. Aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. cho-1(tm373) is a null deletion allele of the gene encoding the plasma membrane choline transporter, and unc-17(e245) is a strong missense allele of the synaptic vesicle acetylcholine transporter. References: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM2209 ric-8(md1909) IV. C. elegans Poor growth and fertility at 25C. Grows well at 20C and is more fertile than ric-8(md303). Degree of aldicarb resistance is similar to md303 but locomotion rate is greater than md303 and embryonic lethality is only 19%, versus 29% for md303. Contains a Tc1 transposon insertion in the middle of the ric-8 coding sequence.
RM2221 egl-8(md1971) V. C. elegans Egl. Ric. Reduced locomotion and pharyngeal pumping. Reduced body flexion at rest, but loopy backing.
RM2431 unc-13(md2415)/hT1 I; +/hT1 V. C. elegans Heterozygotes are WT and segregate WT, hT1 homozygotes (mid-larval lethals), md2415 homozygotes (generally L1 lethals which are almost completely paralyzed and have a coily posture with some head movement), and dead eggs. md2415 has a 2.7 kb deletion in the "unc-13R" region.
RM2576 cho-1(tm373) IV. C. elegans Canonical allele. Superficially wild-type. Frequency of spontaneous reversals approximately twice that of wild type. Initial L4 swimming rate approximately half that of wild type, and decreases steadily for 30 min, until the animals are immobile. Synthetic lethal with pmt-2 RNAi.
RM2702 dat-1(ok157) III. C. elegans Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp.
RM2710 snf-11(ok156) V. C. elegans Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
RM2711 unc-25(e156) III; snf-11(ok156) V. C. elegans Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
RM2715 snf-3(ok293) II; unc-25(e156) III. C. elegans Superficially similar to unc-25 mutants (Shrinker, Exp, etc.). GABA-dependent phenotypes are rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. Peden AS, et al. Nat Neurosci. 2013 Dec;16(12):1794-801.
RM2717 snf-3(ok293) II; unc-25(e156) III; snf-11(ok156) V. C. elegans Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
RM2718 snf-3(ok293) II; snf-11(ok156) V. C. elegans Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
RM2754 dnj-14(ok237) X. C. elegans Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.
RM299 unc-18(md299) X. C. elegans Multigenic deletion that removes the promoter and open reading frame of unc-18. Unc.
RM2999 pha-1(e2123) III; mdIs123. C. elegans mdIs123 [hum-2a/b::YFP + pha-1(+)]. Transcriptional reporter using hum-2a/b promoter to drive YFP expression. hum-2a and hum-2b transcripts are almost identical, and their transcription is presumably controlled by the same promoter. Reference: S. Fields and J. Rand (unpublished).
RM3054 snt-1(md290) II; mdIs126; mdIs129. C. elegans mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.
RM3156 oct-1(gk354) I; cho-1(tm373) IV. C. elegans Slightly Lon and Unc. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM3157 cho-1(tm373) IV; chtl-1(ok1695) X. C. elegans Slightly Lon and Unc. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM3218 pha-1(e2123) III; cho-1(tm373) IV; mdEx790. C. elegans mdEx790 [cho-1p(7.6kb)::cho-1::GFP + pha-1(+) + pBluescript]. CHO-1 translational fusion driven by 7.6 kb cho-1 promoter rescues cho-1 mutant behaviors, including reduced initial thrashing rate, fatigue, and synthetic interactions with pmt-2. Strong fluorescence in nerve ring, and ventral and dorsal nerve cords. Structure of the transgene is shown in Figure 1 of Mullen et al., 2007.
RM3230 pha-1(e2123) III; mdIs139; mdIs152. C. elegans mdIs139 [unc-17p::NLS::YFP + unc-119(+)]. mdIs152 [cho-1p::NLS::CFP + pBlueScript]. Bright YFP CFP fluorescence. A few cells will express only one of the two reporters, and the ratio of the two colors can vary from cell to cell. Worms are relatively healthy and move well. mdIs139 uses 5.2 kb of unc-17 promoter. mdIs152 uses 7.5 kb of cho-1 promoter. References: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204. Pereira LP, et al. Elife. 2015 Dec 25;4. pii: e12432. doi: 10.7554/eLife.12432.
RM3248 oct-1(gk354) I; cho-1(tm373) IV; chtl-1(ok1695) X. C. elegans Approximately wild-type in appearance, growth, and movement. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM3286 snt-1(md290) II; unc-41(e268) V. C. elegans Unc.
RM3325 pha-1(e2123) III; mdEx865. C. elegans mdEx865 [unc-17p::NLS::mCherry + pha-1(+)]. Transcriptional reporter. Nuclear localized mCherry in cholinergic neurons. Maintain at 20-25C to retain array. References: Grundahl K and Rand J, unpublished. Granato M, Schnabel H, and Schnabel R, 1994. Genesis of an organ: molecular analysis of the pha-1 gene. Development 120: 3005–3017.
RM3326 pha-1(e2123) III; mdEx866. C. elegans mdEx866 [unc-17p::NLS::mCherry + pha-1(+)]. Maintain at 20-25C to maintain array. Nuclearly-localized mCherry in cholinergic neurons. References: K. Grundahl and J. Rand (unpublished). Granato MH, et al. Development. 1994 Oct;120(10):3005-17.
RM3571 sup-1(e995 e2636) III. C. elegans Putative null allele; e995 e2636 homozygotes are superficially wild type in appearance, development, and behavior (except for a modest 20-25% decrease in swimming rate), and do not suppress unc-17(e245). e995 corresponds to G84E (gga>>gaa) and e2636 corresponds to W58stop (tgg>>tag). PCR methods for scoring e995 and e2636 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM3643 sup-1(e995 e2636) III; unc-17(e245) IV. C. elegans Indistinguishable from unc-17(e245) single mutants (small, slow-growing, coily uncoordinated, jerky going backward, aldicarb-resistant). For additional information, see descriptions of the RM908 unc-17(e245) IV and RM3671 sup-1(e995 e2636)) III single mutant strains. PCR methods for scoring e245, e995, and e2636 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Derived by crossing RM908 (6x outcrossed) and RM3571 (6x outcrossed). Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM3645 unc-17(e245) IV; snb-1(e1563) V. C. elegans Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3659 snb-1(e1563) V single mutant strains. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.
RM3657 snt-1(md290) II; unc-41(md152) V. C. elegans Very uncoordinated and slow growing.
RM3659 snb-1(e1563) V. C. elegans e1563 homozygotes are superficially wild-type in appearance, development, and behavior. e1563 is a strong, dominant suppressor of UNC-17 G347R mutations (including e245, e359, p300). Molecular details: e1563 corresponds to an I97D (att>>gat) missense mutation in the SNB-1 transmembrane domain. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.
RM3660 sup-1(e995) III; unc-17(e245) IV. C. elegans Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3670 sup-1(e995) III single mutant strains. PCR methods for scoring e245 and e995 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM3670 sup-1(e995) III. C. elegans e995 homozygotes are superficially wild type in appearance, development, and behavior. e995 is a strong, dominant suppressor of UNC-17 G347R mutations (including e245, e359, p300). e995 corresponds to G84E (gga>>gaa) in the SUP-1 transmembrane domain. PCR method for scoring the e995 mutation in individual worms is presented in the Supporting Information File of Mathews et al., 2012. [Note: although it has been suggested that unc-123 and sup-1 represent the same gene (Walthall et al. 1993), sequence analysis demonstrated no molecular lesions at the sup-1 locus in unc-123 mutants (Mathews et al., 2012). Therefore unc-123 and sup-1 represent different genes.] Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM509 ric-3(md158) IV. C. elegans Aldicarb resistant.
RM523 unc-17(cn355) IV. C. elegans cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
RM580 unc-17(md1447) IV. C. elegans md1447 is a spontaneous 465-bp deletion (with a 2-bp insertion) within the unc-17 3'UTR in a TR638 background. Protein level by immunostaining is barely detectible , but unc-17 behavioral phenotypes are relatively mild. Sequence details (in direction of transcription): TCGTAGATTTGGATCTCTGAATATG/Ä465+AA/AGTGATTTCGTATAGAGTAATGTCA . This allele is the only smg-suppressible allele of unc-17 reported thus far. Since the md1447 deletion is entirely within the unc-17 3'UTR, the amino acid sequence of the UNC-17 protein is completely wild-type. Therefore the phenotype derives from the nonsense-mediated decay of the transcript which in turn leads to an extremely low level of wild-type UNC-17 protein (see figure on following page). Many other unc-17 alleles have reduced immunoreactivity (but more immunoreactivity than md1447) yet significantly stronger behavioral phenotypes than md1447. Therefore, the behavioral phenotypes of these other alleles are not due to reduced transporter. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM777 cha-1(md39) IV. C. elegans Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80.
RM908 unc-17(e245) IV. C. elegans Small, slow-growing, coily uncoordinated, jerky going backward, aldicarb- and lannate-resistant. Molecular details: G347R (gga>>aga) in the 9th transmembrane domain of the UNC-17 protein. PCR method for scoring the e245 mutation in individual worms is presented in the Supporting Information File of Mathews et al., 2012.
RM956 ric-4(md1088) V. C. elegans Aldicarb resistant.
RM969 smg-1(md7) I; unc-17(md1447) IV. C. elegans Approximately wild-type for the unc-17 phenotypes; displays typical smg-1 phenotypes (protruding vulvae, defective male tails, poor male mating).

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
md299 Allele deletion
md1756 Allele
md176 Allele
md130 Allele substitution splice_site
md290 Allele deletion
md1117 Allele deletion
md247 Allele insertion frameshift
md186 Allele
md303 Allele substitution
md1909 Transposon insertion insertion
md1971 Allele substitution nonsense
md2415 Allele
md158 Allele
md1088 Allele