Laboratory Information

NameJH View on WormBase
Allele designationax
HeadGeraldine C Seydoux
InstitutionJohns Hopkins University, Baltimore, MD
Address HHMI, Johns hopkins University, SOM
MBG Dpt, PCTB 706
725 N. Wolfe Street,
Baltimore 21205
United States
Website http://seydouxlab.mbg.jhmi.edu/
Gene classes frk  nos  pom  zif 

Strains contributed by this laboratory

Strain Genotype Species Description
BN1062 npp-21(bq1[npp-21::GFP]) bqSi189 II. C. elegans bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. GFP tag inserted at the C-terminus of the endogenous npp-21 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas L, et al. EMBO J. 2023 Jul 3;42(13):e112987. doi: 10.15252/embj.2022112987. PMID: 37254647.
BN740 npp-24(bq15[gfp(FRT)::npp-24]) bqSi189 II. C. elegans bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the npp-248 start codon. FRT sites in GFP introns 1 & 2 enable FLP-mediated conditional knockout; in the absence of FLP, the construct behaves as normal GFP. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas L, et al. bioRxiv 2022.08.22.504855; doi: https://doi.org/10.1101/2022.08.22.504855
JH103 axIs36 X. C. elegans axIs36 [pes-10::GFP + dpy-20(+)] X. Slightly dumpy.
JH1270 nos-1(gv5) II. C. elegans No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.
JH1288 cdk-7(ax224) I. C. elegans Temperature sensitive lethal. Maintain at 15C.
JH1327 axEx73. C. elegans axEx73 [pie-1p::pie-1::GFP + rol-6(su1006) + N2 genomic DNA]. pie-1::GFP is expressed in embryos and oocytes. This array may have integrated spontaneously since the strain segregates 100% Rollers.
JH1448 axEx1125. C. elegans axEx1125 [pie-1p::mex-5::GFP::pie-1 3’UTR + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. Pick Rollers to maintain. axEx1125 contains pKR2.04, a construct carrying MEX-5::GFP in vector pKR1.42; pKR1.42 uses the pie-1 promoter, enhancer, and 3′ UTR to drive maternal expression of GFP in embryos. Animals with the array are Rollers. Animals which have lost the array are WT.
JH1473 itIs153; ojIs1. C. elegans itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C. Constructed by crossing heterozygous ojIs1 males into KK866 (itIs153) hermaphrodites and selecting for double homozygosity of the arrays. itIs153 is an integrated derivitive of axEx1094.
JH1521 puf-8(ok302) II. C. elegans 100% Sterile at 25C. Him and 50% Emb at 20C. Maintain at 15C.
JH1576 unc-119(ed3) III; axIs1140. C. elegans axIs1140 [pie-1p::GFP::mbk-2 + unc-119(+)].
JH1580 unc-24(e1172) mbk-2(pk1427) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. mbk-2(pk1427) is a deletion that removes most of the mbk-2 locus.
JH1964 unc-119(ed3) III; axIs1427. C. elegans axIs1427 [pCG26/ LAP-tag DCP-1]. Reference: Gallo CM, et al. Dev Biol. 2008 Nov 1;323(1):76-87.
JH1986 unc-119(ed3) III; axIs1437. C. elegans axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH1999 unc-119(ed3) III; axIs1448. C. elegans axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Superficially wild-type. Reference: Merritt C, et al. Curr Biol. 2008 Oct 14;18(19):1476-82.
JH2013 unc-119(ed3) III; axIs1460. C. elegans axIs1460 [pie-1p::GFP::pal-1(genomic)::pal-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. pal-1 coding region and 3’ sequences were amplified from genomic DNA and cloned into pDONR201 to create ORF+3’ Entry Clones.
JH2015 unc-119(ed3) III; axIs1462. C. elegans axIs1462 [pie-1p::GFP::pie-1 ORF::pie-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2017 unc-119(ed3) III; axIs1464. C. elegans axIs1464 [pie-1p::GFP::pgl-3 ORF::pgl-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2019 unc-119(ed3) III; axIs1466. C. elegans axIs1466 [pie-1p::GFP::mex-5 ORF::mex-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2024 unc-119(ed3) III; axIs1471. C. elegans axIs1471 [pie-1p::GFP::fbf-1 ORF::fbf-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2054 unc-119(ed3) III; axIs1492. C. elegans axIs1492 [pie-1p::GFP::tbb-2 ORF::tbb-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2060 unc-119(ed3) III; axIs1498. C. elegans axIs1498 [pie-1p::GFP::gld-1 ORF::gld-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2078 unc-119(ed3) III; axIs1504. C. elegans axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2080 unc-119(ed3) III; axIs1506. C. elegans axIs1506 [pie-1p::GFP::exos-1::exos-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2099 unc-119(ed3) III; axIs1486. C. elegans axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH2100 unc-119(ed3) III; axIs1487. C. elegans axIs1487 [pCG81; pie-1p::LAP::patr-1 + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Maintain @ 25C; array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH2107 unc-119(ed3) III; axIs1720. C. elegans axIs1720 [pie-1p::GFP::pgl-1 ORF::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2108 unc-119(ed3) III; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2110 unc-119(ed3) III; axIs1524. C. elegans axIs1524 [pie-1p::GFP::spe-38 ORF::spe-38 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2119 unc-119(ed3) III; axIs1533. C. elegans axIs1533 [pie-1p::GFP::daz-1 ORF::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2120 unc-119(ed3) III; axIs1534. C. elegans axIs1534 [pie-1p::GFP::him-3 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C to retain transgene expression. GFP expressed in synapses. Weaker expression in oocytes and pachytene germline.
JH2156 unc-119(ed3) III; axIs1557. C. elegans axIs1557 [pie-1p::GFP::lip-1 ORF::lip-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2160 unc-119(ed3) III; axIs1561. C. elegans axIs1561 [pie-1p::GFP::nos-3 ORF::nos-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2162 unc-119(ed3) III; axIs1563. C. elegans axIs1563 [pie-1p::GFP::cep-1 ORF::cep-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2163 unc-119(ed3) III; axIs1564. C. elegans axIs1564 [pie-1p::GFP::fog-2 ORF::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2166 unc-119(ed3) III; axIs1567. C. elegans axIs1567 [pie-1p::GFP::spn-4 ORF::spn-4 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is very unstable. Pick non-Unc, GFP+ worms to maintain.
JH2168 unc-119(ed3) III; axIs1569. C. elegans axIs1569 [pie-1p::GFP::msp-142 ORF::msp-142 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2171 unc-119(ed3) III; axIs1586. C. elegans axIs1586 [pie-1::LAP::glh-1::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in P-granules of distal germline.
JH2184 unc-119(ed3) III; axIs1595. C. elegans axIs1595 [pie-1p::GFP::npp-9(orf )::npp-9 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Voronina E & Seydoux G, Development. 2010 May;137(9):1441-50.
JH2194 unc-119(ed3) III; axIs1571. C. elegans axIs1571 [pie-1p::GFP::par-5(orf)::par-5 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2200 unc-119(ed3) III; axIs1577. C. elegans axIs1577 [pie-1p::GFP::histone H2B::nos-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2207 unc-119(ed3) III; axIs1584. C. elegans axIs1584 [pie-1p::GFP::histone H2B::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2220 unc-119(ed3) III; axIs1608. C. elegans axIs1608 [pie-1p::GFP::histone H2B::par-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2221 unc-119(ed3) III; axIs1609. C. elegans axIs1609 [pie-1p::GFP::histone H2B::mex-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2223 unc-119(ed3) III; axIs1611. C. elegans axIs1611 [pie-1p::GFP::histone H2B::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2225 unc-119(ed3) III; axIs1613. C. elegans axIs1613 [pie-1p::GFP::histone H2B::mes-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2228 unc-119(ed3) III; axIs1616. C. elegans axIs1616 [pie-1p::GFP::histone H2B::spe-38 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2236 unc-119(ed3) III; axIs1624. C. elegans axIs1624 [pie-1p::GFP::histone H2B::pal-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2252 unc-119(ed3) III; axIs1640. C. elegans axIs1640 [pie-1p::GFP::histone H2B::glp-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2261 unc-119(ed3) III; axIs1649. C. elegans axIs1649 [pie-1p::GFP::histone H2B::cye-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2267 unc-119(ed3) III; axIs1651. C. elegans axIs1651 [pie-1p::GFP::histone H2B::lip-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2270 unc-119(ed3) III; axIs1654. C. elegans axIs1654 [pie-1p::GFP::histone H2B::fbf-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2281 unc-119(ed3) III; axIs1729. C. elegans axIs1729 [pie-1p::LAP tag::mCherry::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2296 unc-119(ed3) III; axIs1663. C. elegans axIs1663 [pie-1p::GFP::histone H2B::fbf-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2297 unc-119(ed3) III; axIs1664. C. elegans axIs1664 [pie-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2311 unc-119(ed3) III; axIs1668. C. elegans axIs1668 [pie-1p::GFP::histone H2B::spn-4 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2313 unc-119(ed3) III; axIs1670. C. elegans axIs1670 [pie-1p::GFP::histone H2B:rme-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2316 unc-119(ed3) III; axIs1673. C. elegans axIs1673 [pie-1p::GFP::histone H2B::msp-142 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2317 unc-119(ed3) III; axIs1674. C. elegans axIs1674 [pie-1p::GFP::histone H2B::spe-11 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2320 unc-119(ed3) III; axIs1677. C. elegans axIs1677 [pie-1p::GFP::histone H2B::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2324 unc-119(ed3) III; axIs1681. C. elegans axIs1681 [pie-1p::GFP::histone H2B::him-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2329 unc-119(ed3) III; axIs1488. C. elegans axIs1488 [pCG176/ mCherry::patr-1]. Reference: Gallo CM, et al. Dev Biol. 2008 Nov 1;323(1):76-87.
JH2330 unc-119(ed3) III; axIs1488; axIs????. C. elegans axIs1488 [pie-1p::mCherry::patr-1::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2333 unc-119(ed3) III; axIs1688. C. elegans axIs1688 [pie-1p::GFP::histone H2B::mex-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2336 unc-119(ed3) III; axIs1691. C. elegans axIs1691 [pie-1p::GFP::H2B::him-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2342 unc-119(ed3) III; axIs1630. C. elegans axIs1630 [daz-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].
JH2347 unc-119(ed3) III; axIs1694. C. elegans axIs1694 [gld-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].
JH2349 unc-119(ed3) III; axIs1696. C. elegans axIs1696 [pie-1p::GFP::histone H2B:pgl-3 3'utr , unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2365 unc-119(ed3) III; axIs1702. C. elegans axIs1702 [pie-1p::GFP::fbf-2 ORF::fbf-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2366 unc-119(ed3) III; axIs1703. C. elegans axIs1703 [spe-11p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].
JH2373 unc-119(ed3) III; axIs1709. C. elegans axIs1709 [pie-1p::GFP::histone H2B:lip-1M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2377 unc-119(ed3) III; axIs1713. C. elegans axIs1713 [pie-1p::GFP::histone H2B::mes-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is very unstable. Pick non-Unc, GFP+ worms to maintain.
JH2379 unc-119(ed3) III; axIs1715. C. elegans axIs1715 [pie-1p::GFP::histone H2B::pie-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2380 unc-119(ed3) III; axIs1716. C. elegans axIs1716 [pie-1p::GFP::histone H2B::unc-54 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2381 unc-119(ed3) III; axIs1717. C. elegans axIs1717 [pie-1p::GFP::histone H2B::spe-41 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2416 unc-119(ed3) III; axIs1742. C. elegans axIs1742 [lip-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)].
JH2418 unc-119(ed3) III; axIs1721. C. elegans axIs1721 [pie-1p::GFP::histone H2B::puf-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2423 unc-119(ed3) III; axIs1722. C. elegans axIs1722 [pie-1p::GFP::histone H2B::fog-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2427 unc-119(ed3) III; axIs1751. C. elegans axIs1751 [pie-1p::GFP::histone H2B::pos-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2428 unc-119(ed3) III; axIs1752. C. elegans axIs1752 [fbf-1p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.
JH2432 unc-119(ed3) III; axIs1756. C. elegans axIs1756 [fbf-2p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing.
JH2434 unc-119(ed3) III; axIs1758. C. elegans axIs1758 [spn-4p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2435 unc-119(ed3) III; axIs1759. C. elegans axIs1759 [msp-56p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)].
JH2436 unc-119(ed3) III; axIs1723. C. elegans axIs1723 [pie-1p::GFP::histone H2B:gld-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2452 unc-119(ed3) III; axIs1490. C. elegans axIs1490 [pCG230; pie-1p::GFP::ccf-1::ccf-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Dev Bio (2008) 323(1):76-87.
JH2458 unc-119(ed3) III; axIs1735. C. elegans axIs1735 [pie-1p::LAP tag::npp-10 (full length) + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2464 unc-119(ed3) III; axIs1779. C. elegans axIs1779 [pie-1p::mCherry::H2B::tbb-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2471 unc-119(ed3) III; axIs1775. C. elegans axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain.
JH2513 fbf-1(ok91) II; axIs1723. C. elegans axIs1723 [pie-1p::GFP::H2B::gld-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2523 fbf-2(q738) II; axIs1722. C. elegans axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2525 fbf-1(ok91) II; axIs1722. C. elegans axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2549 unc-119(ed3) III; axIs1957. C. elegans axIs1957 [pie-1p::Dendra2::TEV::S-peptide::mex-5::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2550 unc-119(ed3) III; axIs1962. C. elegans axIs1962 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2553 unc-119(ed3) III; axIs1958. C. elegans axIs1958 [pie-1p::Dendra2::TEV::S-peptide::mex-5(aa345-aa468)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2560 unc-119(ed3) III; axIs1959. C. elegans axIs1959 [pie-1p::Dendra2::TEV::S-peptide::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2593 unc-119(ed3) III; axIs1961. C. elegans axIs1961 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2607 unc-119(ed3) III; axIs1963. C. elegans axIs1963 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2621 unc-119(ed3) III; axIs1849. C. elegans axIs1849 [pie-1p::GFP::H2B::htp-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.
JH2623 unc-119(ed3) III; axIs1851. C. elegans axIs1851 [pie-1p::GFP::H2B::rad-51 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.
JH2636 unc-119(ed3) III; axIs1960. C. elegans axIs1960 [pie-1p::Dendra2::TEV::S-peptide::mex-5(C286S C292S C331S C337S)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2647 axIs1928; axIs1182. C. elegans axIs1928 [mCherry::par-6]. axIs1182 [GFP::par-2]. Maintain at 25C to retain transgene expression. [NOTE: axIs1182 [GFP::par-2] might not be integrated; the CGC has received reports that it does not segregate to all progeny.]
JH2648 unc-119(ed3) III; axIs1928. C. elegans axIs1928 [mCherry::par-6].
JH2652 ect-2(ax751) II; zuIs45 V. C. elegans zuIs45 [nmy-2::NMY-2::GFP + unc-119(+)] V. Temperature-sensitive Maternal-effect lethal at 25 C. Maintain at 15-20 C.
JH2657 ect-2(ax751) II; axIs1928; axIs1182. C. elegans axIs1928 [mCherry::par-6]. axIs1182 [GFP::par-2]. Temperature-sensitive Maternal-effect lethal at 25 C. Maintain at 15-20 C.
JH2671 unc-119(ed3) III; axIs1864. C. elegans axIs1864 [pie-1p::GFP::H2B::zim-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in mitotic germline; variable, sometimes weak, GFP expression in pachytene stage.
JH2686 unc-119(ed3) III; axIs1844. C. elegans axIs1844 [GFP::npp-7 + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2688 unc-119(ed3) III; axIs1927. C. elegans axIs1927 [LAPtag::glh-1 + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2691 npp-10(ok467)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. ok467 deletion balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and npp-10 homozygotes (Emb or early Larval lethal). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain.
JH2704 unc-119(ed3) III; axIs1890. C. elegans axIs1890 [pie-1p::GFP::H2B::msh-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Weak GFP expression in mitotic germline; GFP expression in pachytene, oocytes, and embryos.
JH2730 unc-119(ed3) III; axIs1895. C. elegans axIs1895 [pie-1p::GFP::H2B::rec-8 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.
JH2749 unc-119(ed3) III; axIs1914. C. elegans axIs1914 [syp-3p::GFP::syp-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in meiotic germline.
JH2754 ect-2(ax751) II. C. elegans Temperature-sensitive Maternal-effect lethal at 25 C. Maintain at 15-20 C.
JH2756 ect-2(ax751) II; par-3(it71) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; zuIs45 V. C. elegans zuIs45 [nmy-2::NMY-2::GFP + unc-119(+)] V. Temperature-sensitive. Maternal-effect lethal at 25 C. Maintain at 15-20 C. Segregates Unc Mel, non-Unc Mel, non-Unc Ste. Reference: Zonies S, et al. Development. 2010 May;137(10):1669-77.
JH2759 unc-119(ed3) III; axIs1929. C. elegans axIs1929 [nmy-2::GFP + mCherry::par-2]. Reference: Zonies S, et al. Development. 2010 May;137(10):1669-77.
JH2773 unc-119(ed3) III; axIs1946. C. elegans axIs1946 [pie-1p::Dendra::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2787 pptr-1(tm3103) V. C. elegans pptr-1(tm3103) is a temperature-sensitive allele. Maintain at 15C. Fully penetrant P granule partitioning defect at 20-24C. Low penetrance of sterilty observed at 24-26C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2791 pptr-1(tm3103) V; axIs1448. C. elegans axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2794 pptr-1(tm3103) V; axIs1462. C. elegans axIs1462 [pie-1p::GFP::pie-1::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2800 unc-119(ed3) III; axIs1964. C. elegans axIs1964 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2801 unc-119(ed3) III; axIs1965. C. elegans axIs1965 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2802 unc-119(ed3) III; axIs1950. C. elegans axIs1950 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2804 unc-119(ed3) III; axIs1951. C. elegans axIs1951 [pie-1p::Dendra2::TEV::S-peptide::mex-5RR(S404A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2814 unc-119(ed3) III; axIs1933. C. elegans axIs1933 [(pFM034) GFP::par-2 RNAi-resistant + unc-119(+)].
JH2815 unc-119(ed3) III; axIs1934. C. elegans axIs1934 [(pFM035) GFP::par-2 RNAi-resistant [R183-5A] + unc-119(+)].
JH2816 unc-119(ed3) III; axIs1935. C. elegans axIs1935 [(pFM036) GFP::par-2 RNAi-resistant [K162A] + unc-119(+)].
JH2817 unc-119(ed3) III; axIs1936. C. elegans axIs1936 [(pFM037) GFP::par-2 RNAi-resistant [R163A] + unc-119(+)].
JH2825 unc-119(ed3) III; axIs1943. C. elegans axIs1943 [(pFM050) mCherry::mlc-4 + unc-119(+)].
JH2835 pptr-1(tm3103) V; axIs1504. C. elegans axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2836 unc-119(ed3) III; axIs????. C. elegans axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2839 pptr-1(tm3103) V; axIs1522; axIs1929. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. axIs1929 [pie-1p::mCherry::par-2::pie-1 3'UTR + unc-119(+)]. Transgenes are prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2840 unc-119(ed3) III; axIs???? ; axIs1731. C. elegans axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. axIs1731 [pie-1p::mCherry::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2841 pptr-1(tm3103) V; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2874 pgl-1(ct131) him-3(e1147) III; ozIs5. C. elegans ozIs5 [gld-1::GFP + unc-119(+)].
JH2877 fbf-2(q738) II; pgl-1(ct131) him-3(e1147) III; axIs1722. C. elegans axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2883 fbf-1(ok91) II; pgl-1(ct131) him-3(e1147) III; axIs1722. C. elegans axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2889 unc-119(ed3) III; axIs1955. C. elegans axIs1955 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(S458A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2890 unc-119(ed3) III; axIs1956. C. elegans axIs1956 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(R274E K318E)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2919 unc-119(ed3) III; axIs2000. C. elegans axIs2000 [LAPtag::fbf-2::fbf-2 3'UTR]. Maintain at 25C to maintain transgene expression.
JH2929 fbf-1(ok91) II; axIs2000. C. elegans axIs2000 [LAPtag::fbf-2::fbf-2 3'UTR]. Maintain at 25C to maintain transgene expression.
JH2932 unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. C. elegans ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH2996 cdc-37(ax2001) II; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH2997 plk-1(ax2002) III; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH2998 emb-30(ax2003) III; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH2999 mbk-2(dd5ax2004) IV. C. elegans Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3000 mbk-2(dd5ax2005) IV. C. elegans Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3002 mbk-2(dd5ax2007) IV. C. elegans Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3003 plk-1(ax2008) III; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3004 tat-4(ax2009) II; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3005 such-1(ax2010) III; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3006 mus-101(ax2011) I; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3009 fzy-1(ax2014) II; mbk-2(dd5) IV. C. elegans Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3011 cdc-37(ax2001) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3012 plk-1(ax2002) unc-119(ed3) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3013 unc-119(ed3) orIs1 III; mbk-2(dd5ax2004) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3016 unc-119(ed3) III; axIs2076. C. elegans axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3019 unc-119(ed3) III; axIs2076; axIs2077. C. elegans axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. axIs2077 [pie-1p::GFP::pgl-3::pie-1 3'UTR]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3055 meg-3(tm4259) X. C. elegans Mild embryonic P granule defect. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3064 pptr-1(tm3103) V; axIs2076. C. elegans axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3075 tat-4(ax2009) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3076 unc-119(ed3) such-1(ax2010) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3078 apc-1(ax2012) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Formerly known as mat-2. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3080 fzy-1(ax2014) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3086 emb-30(ax2003) unc-119(ed3) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3087 xpo-2(ax2013) I; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. C. elegans orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3134 swan-1(ax2045[V5::swan-1]) V. C. elegans V5 tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3136 swan-1(ax2047[Myc::swan-1]) V. C. elegans Myc tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3147 ltIs37 IV; meg-3(tm4259) X; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3148 ltIs37 IV; meg-1(vr10) X; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3149 ltIs37 IV; meg-3(tm4259) meg-4(ax2026) X; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3150 ltIs37 IV; meg-1(vr10) meg-3(tm4259) X; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3153 meg-3(tm4259) X; axIs2076. C. elegans axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3155 ltIs37 IV; pptr-1(tm3103) V; meg-3(tm4259) X; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3156 ltIs37 IV; pptr-1(tm3103) V; meg-1(vr10) X; axIs1522. C. elegans axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3158 swan-1&swan-2(ax2071) V. C. elegans Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801593-13807217) and insertion of ATTTGTTCAGACAATAAGCTNGAAATC. No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3159 swan-1&swan-2(ax2072) V. C. elegans Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801629-13807223). No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3176 gtbp-1(ax2029) IV. C. elegans Deletion/insertion (AGCTAGC) of a STOP codon/frameshift near the ATG between IV: 10128909...10128934. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3180 nos-2(ax2033) II. C. elegans Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3182 gtbp-1(ax2035[gtbp-1::TetraCys]) IV. C. elegans Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3184 gtbp-1(ax2037([gtbp-1::Myc]) IV. C. elegans Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3186 gtbp-1(ax2039[gtbp-1::3xFlag]) IV. C. elegans Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 mex-5(ax2041[3xFLAG::mex-5]) IV. C. elegans Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3190 mex-5(ax2043[OLLAS::mex-5]) IV. C. elegans Maintain at 20C. OLLAS-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 nos-2(ax2049[3XFLAG::nos-2]) II. C. elegans Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3195 mbk-2(ax2051[V5::mbk-2]) IV. C. elegans V5 tag inserted at the N-terminus of mbk-2 isoform a. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3197 gtbp-1(ax2053[gtbp-1::GFP]) IV. C. elegans Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3199 gtbp-1(ax2055[gtbp-1::GFP]) IV. C. elegans Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3201 fbf-2(ax2057[fbf-2::GFP]) II. C. elegans Maintain at 20-25C. ax2057 was produced by mutation of the sgRNA site and insertion of GFP cDNA at the C-terminus of fbf-2. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of fbf-2: ATCATCGCCGTGACTACCA(GFP) between II:6089145...6089165. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3203 mes-2(ax2059[mes-2::GFP]) II. C. elegans Maintain at 20C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of mes-2 between II:14388297...14388298. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3205 lin-15B(ax2061[lin-15B::GFP]) X. C. elegans Maintain at 20C. Nuclear expression of lin-15B::GFP in oocytes and embryos. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3207 deps-1(ax2063[deps-1::GFP]) I. C. elegans Maintain at 20C. GFP inserted at N-terminus of deps-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3209 mex-6(ax2065[mex-6::GFP]) II. C. elegans GFP-tagged mex-6. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3212 gtbp-1(ax2068) IV. C. elegans 1.6kb deletion in gtbp-1 between IV: 10127256...10128923. Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3215 gtbp-1(ax2073) IV. C. elegans 1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3225 meg-3(tm4259) meg-4(ax2026) X. C. elegans P granule defect. High sterility. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3229 meg-1(vr10) meg-3(tm4259) X. C. elegans P granule defect. Some sterility. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3230 pgl-3(bn104) V; axIs2076. C. elegans axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3247 meg-4(ax2080[meg-4::FLAG]) X. C. elegans C-terminal FLAG insertion in endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3248 meg-4(ax2081) X. C. elegans Deletion removing 733 base pairs upstream of start and the first 2565 bases of the endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3269 pgl-1(ax3122[pgl-1::gfp]) IV. C. elegans GFP inserted at C terminus of endogenous pgl-1 locus. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226.
JH3296 mex-5(ax3050[mCherry::mex-5]) IV. C. elegans mCherry tag inserted into endogenous mex-5 locus. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198.
JH3308 gtbp-1(ax5000[gtbp-1::tagRFP]) IV. C elegans tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.
JH3379 meg-1(ax4534[meg-1::gfp]) X. C. elegans GFP tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602.
JH3407 meg-1(ax4535[meg-1::OLLAS]) X. C. elegans OLLAS tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602.
JH3475 meg-3(ax3055) meg-4(ax3052) X. C. elegans Embryonic P granules not segregated, 30% maternal effect sterility on average, RNAi insensitivity. meg-3(ax3055) and meg-4(ax3052) are precise deletions of the entire coding sequence made by CRISPR/Cas9, designed to be cut again to make insertions at the endogenous locus. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
JH3477 meg-3(ax3051[meg-3::OLLAS]) meg-4(ax3052) X. C. elegans P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
JH3503 meg-3(ax3054[meg-3::meGFP]) X. C. elegans meGFP inserted between P121 and V122 of endogenous MEG-3. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226. Smith et al. Elife. 2016 Dec 3;5. pii: e21337.
JH3553 meg-3(ax4503[del(1-544)::OLLAS]) meg-4(ax4504) X. C. elegans Description: 20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (1-544); MEG-3 does not form a cytoplasmic gradient but does still form granules in early embryos and co-localizes with PGL-3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
JH3562 gtbp-1(ax5000[gtbp-1::tagRFP]) IV; meg-3(ax3054[meg-3::meGFP]) X. C. elegans tagRFP tag inserted into endogenous gtbp-1 locus. meGFP tag inserted between P121 and V122 of endogenous MEG-3. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.
JH3571 mut-16(ax4313[mut-16::meGFP]) I. C. elegans meGFP tag inserted at C-terminus of endogenous mut-16 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH3614 par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X. C. elegans meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH3616 par-1(ax4206[par-1::meGFP]) V. C. elegans meGFP tag inserted at C-terminus of endogenous par-1 locus. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH3619 par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). C.elegans qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH3644 fog-2(q71) V; meg-3(ax4320[meg-3::mCherry]) X. C. elegans mCherry inserted at C terminus of endogenous meg-3 locus. fog-2(q71) is male/female strain. Maintain by mating. XX animals are female. XO animals are WT males. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226.
JH3657 pgl-3(ax4300[pgl-3::mCherry]) fog-2(q71) V. C. elegans mCherry inserted at C terminus of endogenous pgl-3 locus. fog-2(q71) is male/female strain. Maintain by mating. XX animals are female. XO animals are WT males. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226.
JH3678 mex-5(ax3050[mCherry::mex-5])/nT1[qIs51] IV; par-1(ax4209[par-1(T983A)::meGFP])/nT1[qIs51] V. C. elegans qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.
JH3679 mex-5(ax3050[mCherry::mex-5]) IV; par-1(ax4206[par-1::meGFP]) V. C. elegans qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Homozygous mex-5(ax3050[mCherry::mex-5]); par-1(ax4206[par-1::meGFP]) animals are fully viable and fertile. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.
JH3861 meg-3(ax4502[meg-3(F705A,Y708A,Y713A, N725A)::OLLAS]) meg-4(ax3052) X. C. elegans 20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
JH3867 bqSi189 II; npp-10(ax4538[mNeonGreen::npp-10]) III. C. elegans bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-10 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH3872 npp-14(ax4548[npp-14::OLLAS]) I. C. elegans OLLAS is inserted at the C-terminus of the endogenous npp-14 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH3886 npp-14(ax4543) I. C. elegans ax4523 is a deletion residues 24-1387 of the npp-14 coding region. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH3904 tdp-1(ax4546[tdp-1::wrmScarlet]) II. C. elegans wrmScarlet is inserted at the C-terminus of the endogenous tdp-1 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH3906 ran-2(ax4545[ran-2::wrmScarlet]) III. C. elegans wrmScarlet is inserted at the C-terminus of the endogenous ran-2 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH3929 pos-1(tn1730[gfp::3xflag::pos-1]) V; meg-3(ax3055) meg-4(ax3052) X. C. elegans Allows visualization of POS-1 protein in the absence of embryonic P granules. Derived by crossing parental strains DG4222 and JH3475. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH3938 bqSi189 II; npp-9(ax4540[mNeonGreen::npp-9]) III. C. elegans bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-9 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH3944 npp-12(ax4544) I. C. elegans ax4544 is a CRISPR-engineered null mutant of npp-12. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH3955 bqSi189 II; xpo-1(ax4542[xpo-1::mNeonGreen]) V. C. elegans bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the C-terminus of the endogenous xpo-1 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4008 htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. C. elegans Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
JH4012 gtbp-1(ax4561[gtbp-1p::IBB domain::mNeonGreen::gtbp-1 3'utr]) IV. C. elegans The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4072 pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. C. elegans 3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JH4073 pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. C. elegans 3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JH4201 npp-11(ax4547[npp-11::wrmScarlet]) I. C. elegans wrmScarlet is inserted at the C-terminus of the endogenous npp-11 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4202 npp-22(ax4549[npp-22::wrmScarlet]) V. C. elegans wrmScarlet is inserted at the C-terminus of the endogenous npp-22 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4410 ifet-1(ax4582[ifet-1::3xHA]) III. C. elegans 3xHA tag inserted at C-terminus of endogenous ifet-1 locus. CRISPR Guide sequence: ttaaacccatatttCTACTT. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH4416 npp-12(ax4539[npp-12::mNeonGreen]) I. C. elegans mNeonGreen tag inserted at the C-terminus of the endogenous npp-12 locus. Reference: Thomas L, et al. EMBO J. 2023 Jul 3;42(13):e112987. doi: 10.15252/embj.2022112987. PMID: 37254647.
JH4467 npp-14(syb8024[npp-14::mNeonGreen]) I. C. elegans mNeonGreen tag inserted at the C-terminus of the endogenous npp-14 locus. NPP-14::mNeonGreen is expressed in all tissues. Reference: Thomas L, et al. Development. 2025 Mar 15;152(6):dev204585. doi: 10.1242/dev.204585. PMID: 40067309.
JH4473 imb-1(syb8052[mNeonGreen::imb-1]) I. C. elegans mNeonGreen tag inserted at N-terminus of endogenous imb-1 locus. Expressed in all tissues. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH4476 nucl-1(syb8070[nucl-1::wrmScarlet]) IV. C. elegans wrmScarlet tag inserted at C-terminus of endogenous nucl-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH4484 npp-11(4585[npp-11::AID*::3xFLAG]) I. C. elegans AID*::3xFLAG tags inserted at C-terminus of endogenous npp-11 locus. AID* is a minimal AID construct of 44 amino acids (https://academic.oup.com/genetics/article/217/3/iyab006/6104563). Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH4504 glh-1(ax4587[glh-1(del18-236) I. C. elegans ax4587 is a CRISPR-engineered deletion removing the FGG repeats of GLH-1. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH4804 ccf-1(ax4572[ccf-1::Spot-tag]) III. C. elegans Spot-tag inserted at C-terminus of endogenous ccf-1 locus. CRISPR Guide sequence: GGAACTCCGATTAGGCCTTG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH4816 car-1(syb8217[car-1::wrmScarlet] I. C. elegans wrmScarlet tag inserted at C-terminus of endogenous car-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JH4852 zif-1(egx157[7xHA::zif-1]) III. C. elegans 7xHA tag inserted at N-terminus of endogenous zif-1 locus. NOTE: egx157 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. CRISPR Guide sequence: ATATGTATCTAATTACAGAG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH4876 nos-2(egx211[7xHA::nos-2]) II. C. elegans 7xHA tag inserted at N-terminus of endogenous nos-2 locus. NOTE: egx211 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. CRISPR Guide sequence: TTCTTCTTGAAAGATGTCTC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH4877 nos-2(egx211[7xHA::nos-2]) II; meg-1(vr10) X. C. elegans 7xHA tag inserted at N-terminus of endogenous nos-2 locus. Minor maternal effect sterility at 20C; increased sterility at 25C. Derived by crossing parental strains YL139 and JH4876. NOTE: egx211 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. egx211 CRISPR Guide sequence: TTCTTCTTGAAAGATGTCTC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH4878 nos-2(egx211[7xHA::nos-2]) II; meg-3(ax3055) meg-4(ax3052) X. C. elegans 7xHA tag inserted at N-terminus of endogenous nos-2 locus. Embryonic P granules fail to segregate. 30% maternal effect sterility on average. RNAi insensitivity. Derived by crossing parental strains JH3475 and JH4876. NOTE: egx211 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. egx211 CRISPR Guide sequence: TTCTTCTTGAAAGATGTCTC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH4940 xnd-1(ax4606[8xAlfa-Tag::xnd-1]) III. C. elegans 8xAlfa-Tag inserted at N-terminus of endogenous xnd-1 locus. CRISPR Guide sequence: AATGGGTTCAGAAGACATCC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH5098 xnd-1(ax4606[8xAlfa-Tag::xnd-1]) III; meg-3(ax3055) meg-4(ax3052) X. C. elegans 8xAlfa-Tag inserted at N-terminus of endogenous xnd-1 locus. Embryonic P granules fail to segregate. 30% maternal effect sterility on average. RNAi insensitivity. Derived by crossing parental strains JH3475 and JH4940. ax4606 CRISPR Guide sequence: AATGGGTTCAGAAGACATCC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH5284 glh-1(sam24[glh-1::GFP::3xFLAG) rps-6(rns6[rps-6::mCherry]) I. C. elegans GFP::3xFlag tags inserted at C-terminus of endogenous glh-1 locus. mCherry tag inserted at C-terminus of endogenous rps-6 locus. Dual fluorescent tags allow visualization of ribosomes and germ granules. Derived by crossing parental strains DUP64 and JAR16. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
JH5286 glh-1(ust406[mCherry::glh-1]) I; eif-1.A(qy90[eif-1.A::mNG]) IV. C. elegans mCherry tag inserted at N-terminus of endogenous glh-1 locus. mNG tag inserted at C-terminus of endogenous eif-1.A locus. Dual fluorescent tags allow simultaneous visualization of ribosomes and germ granules. Derived by crossing parental strains SHG2848 and NK2621. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
KK866 itIs153. C. elegans itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. itIs153 is an integrated derivitive of axEx1094.
PHX8273 dcap-1(syb8273[HA::dcap-1]) IV. C. elegans HA tag inserted at N-terminus of endogenous dcap-1 locus. CRISPR Guide sequence: aaaactcaacattttcatcc. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX8426 dcap-2(syb8426[dcap-2::Spot-tag]) IV. C. elegans Superficially wild-type. Spot-tag inserted at the C-terminus of the endogenous dcap-2 locus. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9016 gld-2(syb9016[mNG::gld-2a]) I. C. elegans mNeonGreen tag inserted at N-terminus of endogenous gld-2 locus tags only long (A) isoform of GLD-2. CRISPR Guide sequence: ttttgtcgccaatATGGTTA. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9021 ifg-1(syb9021[ifg-1::mNG]) II. C. elegans mNeonGreen tag inserted at C-terminus of endogenous ifg-1 locus. CRISPR Guide sequence: ACGTTGTCGAGCTATTTGAC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9249 eif-3.b(syb9249[eif-3.b::wrmScarlett]) II. C. elegans wrmScarlett tag inserted into endogenous eif-3.d locus. CRISPR Guide sequence: ACAAGCCCCTCTGACGGAGG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9252 eif-3.d(syb9252[eif-3.d::AID*::3xFLAG::mNeonGreen]) III. C. elegans AID*::3xFlag::mNG tags inserted into C-terminus of endogenous eif-3.d locus. CRISPR Guide sequence: ATGACGATCAATAAagtccc. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9257 iffb-1(syb9257[iffb-1::linker::sfGFP]) III. C. elegans sfGFP tag with linker inserted at C-terminus of endogenous iffb-1 locus. CRISPR Guide sequence: TTCTTCGGCGGCATtttcgg. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9283 eif-2alpha(syb9283[eif-2alpha::linker::sfGFP]) I. C. elegans sfGFP tag with linker inserted at C-terminus of endogenous eif-2alpha locus. CRISPR Guide sequence: CGATGAAGACAGTGATGAGG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9379 inf-1(syb9379[eGFP::linker::inf-1]) III. C. elegans eGFP tag with linker inserted at N-terminus of endogenous inf-1 locus. CRISPR Guide sequence: GTTCACATCATTTTTAACAT. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.
PHX9406 iff-2(syb9406[mNG::linker::iff-2]) II. C. elegans mNeonGreen tag with linker inserted at N-terminus of endogenous iff-2 locus. CRISPR Guide sequence: GTGATGATCGTCAGACATat. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
ax68 Allele substitution
ax161 Allele substitution
ax144 Allele substitution
ax81 Allele
ax76 Allele substitution
ax102 Allele substitution
ax224 Allele substitution
ax751 Allele substitution
ax2001 substitution
ax2002 substitution
ax2003
ax2004 substitution
ax2005 substitution
ax2007 substitution
ax2008 substitution
ax2009 substitution
ax2010 substitution
ax2011 substitution
ax2014 substitution
ax2012 substitution
ax2013 substitution
ax2071 Allele deletion
ax2072 Allele deletion
ax2029 Allele substitution
ax2033 Allele substitution
ax2068 Allele deletion
ax2073 Allele insertion
ax701 Allele substitution
ax514 Allele substitution