Laboratory Information
| Name | JH View on WormBase |
|---|---|
| Allele designation | ax |
| Head | Geraldine C Seydoux |
| Institution | Johns Hopkins University, Baltimore, MD |
| Address | HHMI, Johns hopkins University, SOM MBG Dpt, PCTB 706 725 N. Wolfe Street, Baltimore 21205 United States |
| Website | http://seydouxlab.mbg.jhmi.edu/ |
| Gene classes | frk nos pom zif |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| BN1062 | npp-21(bq1[npp-21::GFP]) bqSi189 II. | C. elegans | bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. GFP tag inserted at the C-terminus of the endogenous npp-21 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas L, et al. EMBO J. 2023 Jul 3;42(13):e112987. doi: 10.15252/embj.2022112987. PMID: 37254647. |
| BN740 | npp-24(bq15[gfp(FRT)::npp-24]) bqSi189 II. | C. elegans | bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the npp-248 start codon. FRT sites in GFP introns 1 & 2 enable FLP-mediated conditional knockout; in the absence of FLP, the construct behaves as normal GFP. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas L, et al. bioRxiv 2022.08.22.504855; doi: https://doi.org/10.1101/2022.08.22.504855 |
| JH103 | axIs36 X. | C. elegans | axIs36 [pes-10::GFP + dpy-20(+)] X. Slightly dumpy. |
| JH1270 | nos-1(gv5) II. | C. elegans | No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF. |
| JH1288 | cdk-7(ax224) I. | C. elegans | Temperature sensitive lethal. Maintain at 15C. |
| JH1327 | axEx73. | C. elegans | axEx73 [pie-1p::pie-1::GFP + rol-6(su1006) + N2 genomic DNA]. pie-1::GFP is expressed in embryos and oocytes. This array may have integrated spontaneously since the strain segregates 100% Rollers. |
| JH1448 | axEx1125. | C. elegans | axEx1125 [pie-1p::mex-5::GFP::pie-1 3’UTR + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. Pick Rollers to maintain. axEx1125 contains pKR2.04, a construct carrying MEX-5::GFP in vector pKR1.42; pKR1.42 uses the pie-1 promoter, enhancer, and 3′ UTR to drive maternal expression of GFP in embryos. Animals with the array are Rollers. Animals which have lost the array are WT. |
| JH1473 | itIs153; ojIs1. | C. elegans | itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C. Constructed by crossing heterozygous ojIs1 males into KK866 (itIs153) hermaphrodites and selecting for double homozygosity of the arrays. itIs153 is an integrated derivitive of axEx1094. |
| JH1521 | puf-8(ok302) II. | C. elegans | 100% Sterile at 25C. Him and 50% Emb at 20C. Maintain at 15C. |
| JH1576 | unc-119(ed3) III; axIs1140. | C. elegans | axIs1140 [pie-1p::GFP::mbk-2 + unc-119(+)]. |
| JH1580 | unc-24(e1172) mbk-2(pk1427) IV/nT1 [let-?(m435)] (IV;V). | C. elegans | Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. mbk-2(pk1427) is a deletion that removes most of the mbk-2 locus. |
| JH1964 | unc-119(ed3) III; axIs1427. | C. elegans | axIs1427 [pCG26/ LAP-tag DCP-1]. Reference: Gallo CM, et al. Dev Biol. 2008 Nov 1;323(1):76-87. |
| JH1986 | unc-119(ed3) III; axIs1437. | C. elegans | axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87. |
| JH1999 | unc-119(ed3) III; axIs1448. | C. elegans | axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Superficially wild-type. Reference: Merritt C, et al. Curr Biol. 2008 Oct 14;18(19):1476-82. |
| JH2013 | unc-119(ed3) III; axIs1460. | C. elegans | axIs1460 [pie-1p::GFP::pal-1(genomic)::pal-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. pal-1 coding region and 3’ sequences were amplified from genomic DNA and cloned into pDONR201 to create ORF+3’ Entry Clones. |
| JH2015 | unc-119(ed3) III; axIs1462. | C. elegans | axIs1462 [pie-1p::GFP::pie-1 ORF::pie-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2017 | unc-119(ed3) III; axIs1464. | C. elegans | axIs1464 [pie-1p::GFP::pgl-3 ORF::pgl-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2019 | unc-119(ed3) III; axIs1466. | C. elegans | axIs1466 [pie-1p::GFP::mex-5 ORF::mex-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2024 | unc-119(ed3) III; axIs1471. | C. elegans | axIs1471 [pie-1p::GFP::fbf-1 ORF::fbf-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2054 | unc-119(ed3) III; axIs1492. | C. elegans | axIs1492 [pie-1p::GFP::tbb-2 ORF::tbb-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2060 | unc-119(ed3) III; axIs1498. | C. elegans | axIs1498 [pie-1p::GFP::gld-1 ORF::gld-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2078 | unc-119(ed3) III; axIs1504. | C. elegans | axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2080 | unc-119(ed3) III; axIs1506. | C. elegans | axIs1506 [pie-1p::GFP::exos-1::exos-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2099 | unc-119(ed3) III; axIs1486. | C. elegans | axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87. |
| JH2100 | unc-119(ed3) III; axIs1487. | C. elegans | axIs1487 [pCG81; pie-1p::LAP::patr-1 + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Maintain @ 25C; array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87. |
| JH2107 | unc-119(ed3) III; axIs1720. | C. elegans | axIs1720 [pie-1p::GFP::pgl-1 ORF::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2108 | unc-119(ed3) III; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2110 | unc-119(ed3) III; axIs1524. | C. elegans | axIs1524 [pie-1p::GFP::spe-38 ORF::spe-38 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2119 | unc-119(ed3) III; axIs1533. | C. elegans | axIs1533 [pie-1p::GFP::daz-1 ORF::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2120 | unc-119(ed3) III; axIs1534. | C. elegans | axIs1534 [pie-1p::GFP::him-3 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C to retain transgene expression. GFP expressed in synapses. Weaker expression in oocytes and pachytene germline. |
| JH2156 | unc-119(ed3) III; axIs1557. | C. elegans | axIs1557 [pie-1p::GFP::lip-1 ORF::lip-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2160 | unc-119(ed3) III; axIs1561. | C. elegans | axIs1561 [pie-1p::GFP::nos-3 ORF::nos-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2162 | unc-119(ed3) III; axIs1563. | C. elegans | axIs1563 [pie-1p::GFP::cep-1 ORF::cep-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2163 | unc-119(ed3) III; axIs1564. | C. elegans | axIs1564 [pie-1p::GFP::fog-2 ORF::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2166 | unc-119(ed3) III; axIs1567. | C. elegans | axIs1567 [pie-1p::GFP::spn-4 ORF::spn-4 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is very unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2168 | unc-119(ed3) III; axIs1569. | C. elegans | axIs1569 [pie-1p::GFP::msp-142 ORF::msp-142 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2171 | unc-119(ed3) III; axIs1586. | C. elegans | axIs1586 [pie-1::LAP::glh-1::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in P-granules of distal germline. |
| JH2184 | unc-119(ed3) III; axIs1595. | C. elegans | axIs1595 [pie-1p::GFP::npp-9(orf )::npp-9 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Voronina E & Seydoux G, Development. 2010 May;137(9):1441-50. |
| JH2194 | unc-119(ed3) III; axIs1571. | C. elegans | axIs1571 [pie-1p::GFP::par-5(orf)::par-5 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2200 | unc-119(ed3) III; axIs1577. | C. elegans | axIs1577 [pie-1p::GFP::histone H2B::nos-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2207 | unc-119(ed3) III; axIs1584. | C. elegans | axIs1584 [pie-1p::GFP::histone H2B::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2220 | unc-119(ed3) III; axIs1608. | C. elegans | axIs1608 [pie-1p::GFP::histone H2B::par-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2221 | unc-119(ed3) III; axIs1609. | C. elegans | axIs1609 [pie-1p::GFP::histone H2B::mex-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2223 | unc-119(ed3) III; axIs1611. | C. elegans | axIs1611 [pie-1p::GFP::histone H2B::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2225 | unc-119(ed3) III; axIs1613. | C. elegans | axIs1613 [pie-1p::GFP::histone H2B::mes-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2228 | unc-119(ed3) III; axIs1616. | C. elegans | axIs1616 [pie-1p::GFP::histone H2B::spe-38 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2236 | unc-119(ed3) III; axIs1624. | C. elegans | axIs1624 [pie-1p::GFP::histone H2B::pal-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2252 | unc-119(ed3) III; axIs1640. | C. elegans | axIs1640 [pie-1p::GFP::histone H2B::glp-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2261 | unc-119(ed3) III; axIs1649. | C. elegans | axIs1649 [pie-1p::GFP::histone H2B::cye-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2267 | unc-119(ed3) III; axIs1651. | C. elegans | axIs1651 [pie-1p::GFP::histone H2B::lip-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2270 | unc-119(ed3) III; axIs1654. | C. elegans | axIs1654 [pie-1p::GFP::histone H2B::fbf-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2281 | unc-119(ed3) III; axIs1729. | C. elegans | axIs1729 [pie-1p::LAP tag::mCherry::nos-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2296 | unc-119(ed3) III; axIs1663. | C. elegans | axIs1663 [pie-1p::GFP::histone H2B::fbf-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2297 | unc-119(ed3) III; axIs1664. | C. elegans | axIs1664 [pie-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2311 | unc-119(ed3) III; axIs1668. | C. elegans | axIs1668 [pie-1p::GFP::histone H2B::spn-4 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2313 | unc-119(ed3) III; axIs1670. | C. elegans | axIs1670 [pie-1p::GFP::histone H2B:rme-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2316 | unc-119(ed3) III; axIs1673. | C. elegans | axIs1673 [pie-1p::GFP::histone H2B::msp-142 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2317 | unc-119(ed3) III; axIs1674. | C. elegans | axIs1674 [pie-1p::GFP::histone H2B::spe-11 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2320 | unc-119(ed3) III; axIs1677. | C. elegans | axIs1677 [pie-1p::GFP::histone H2B::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2324 | unc-119(ed3) III; axIs1681. | C. elegans | axIs1681 [pie-1p::GFP::histone H2B::him-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2329 | unc-119(ed3) III; axIs1488. | C. elegans | axIs1488 [pCG176/ mCherry::patr-1]. Reference: Gallo CM, et al. Dev Biol. 2008 Nov 1;323(1):76-87. |
| JH2330 | unc-119(ed3) III; axIs1488; axIs????. | C. elegans | axIs1488 [pie-1p::mCherry::patr-1::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2333 | unc-119(ed3) III; axIs1688. | C. elegans | axIs1688 [pie-1p::GFP::histone H2B::mex-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2336 | unc-119(ed3) III; axIs1691. | C. elegans | axIs1691 [pie-1p::GFP::H2B::him-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2342 | unc-119(ed3) III; axIs1630. | C. elegans | axIs1630 [daz-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)]. |
| JH2347 | unc-119(ed3) III; axIs1694. | C. elegans | axIs1694 [gld-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)]. |
| JH2349 | unc-119(ed3) III; axIs1696. | C. elegans | axIs1696 [pie-1p::GFP::histone H2B:pgl-3 3'utr , unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2365 | unc-119(ed3) III; axIs1702. | C. elegans | axIs1702 [pie-1p::GFP::fbf-2 ORF::fbf-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2366 | unc-119(ed3) III; axIs1703. | C. elegans | axIs1703 [spe-11p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)]. |
| JH2373 | unc-119(ed3) III; axIs1709. | C. elegans | axIs1709 [pie-1p::GFP::histone H2B:lip-1M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2377 | unc-119(ed3) III; axIs1713. | C. elegans | axIs1713 [pie-1p::GFP::histone H2B::mes-3 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is very unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2379 | unc-119(ed3) III; axIs1715. | C. elegans | axIs1715 [pie-1p::GFP::histone H2B::pie-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2380 | unc-119(ed3) III; axIs1716. | C. elegans | axIs1716 [pie-1p::GFP::histone H2B::unc-54 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2381 | unc-119(ed3) III; axIs1717. | C. elegans | axIs1717 [pie-1p::GFP::histone H2B::spe-41 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2416 | unc-119(ed3) III; axIs1742. | C. elegans | axIs1742 [lip-1p::GFP::histone H2B::tbb-2 3'utr + unc-119(+)]. |
| JH2418 | unc-119(ed3) III; axIs1721. | C. elegans | axIs1721 [pie-1p::GFP::histone H2B::puf-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2423 | unc-119(ed3) III; axIs1722. | C. elegans | axIs1722 [pie-1p::GFP::histone H2B::fog-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2427 | unc-119(ed3) III; axIs1751. | C. elegans | axIs1751 [pie-1p::GFP::histone H2B::pos-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2428 | unc-119(ed3) III; axIs1752. | C. elegans | axIs1752 [fbf-1p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing. |
| JH2432 | unc-119(ed3) III; axIs1756. | C. elegans | axIs1756 [fbf-2p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Maintaining at 25C might reduce the chance of transgene silencing. |
| JH2434 | unc-119(ed3) III; axIs1758. | C. elegans | axIs1758 [spn-4p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain. |
| JH2435 | unc-119(ed3) III; axIs1759. | C. elegans | axIs1759 [msp-56p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. |
| JH2436 | unc-119(ed3) III; axIs1723. | C. elegans | axIs1723 [pie-1p::GFP::histone H2B:gld-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. |
| JH2452 | unc-119(ed3) III; axIs1490. | C. elegans | axIs1490 [pCG230; pie-1p::GFP::ccf-1::ccf-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Dev Bio (2008) 323(1):76-87. |
| JH2458 | unc-119(ed3) III; axIs1735. | C. elegans | axIs1735 [pie-1p::LAP tag::npp-10 (full length) + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2464 | unc-119(ed3) III; axIs1779. | C. elegans | axIs1779 [pie-1p::mCherry::H2B::tbb-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2471 | unc-119(ed3) III; axIs1775. | C. elegans | axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain. |
| JH2513 | fbf-1(ok91) II; axIs1723. | C. elegans | axIs1723 [pie-1p::GFP::H2B::gld-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background. |
| JH2523 | fbf-2(q738) II; axIs1722. | C. elegans | axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background. |
| JH2525 | fbf-1(ok91) II; axIs1722. | C. elegans | axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background. |
| JH2549 | unc-119(ed3) III; axIs1957. | C. elegans | axIs1957 [pie-1p::Dendra2::TEV::S-peptide::mex-5::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2550 | unc-119(ed3) III; axIs1962. | C. elegans | axIs1962 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2553 | unc-119(ed3) III; axIs1958. | C. elegans | axIs1958 [pie-1p::Dendra2::TEV::S-peptide::mex-5(aa345-aa468)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2560 | unc-119(ed3) III; axIs1959. | C. elegans | axIs1959 [pie-1p::Dendra2::TEV::S-peptide::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2593 | unc-119(ed3) III; axIs1961. | C. elegans | axIs1961 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2607 | unc-119(ed3) III; axIs1963. | C. elegans | axIs1963 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2621 | unc-119(ed3) III; axIs1849. | C. elegans | axIs1849 [pie-1p::GFP::H2B::htp-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos. |
| JH2623 | unc-119(ed3) III; axIs1851. | C. elegans | axIs1851 [pie-1p::GFP::H2B::rad-51 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos. |
| JH2636 | unc-119(ed3) III; axIs1960. | C. elegans | axIs1960 [pie-1p::Dendra2::TEV::S-peptide::mex-5(C286S C292S C331S C337S)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2647 | axIs1928; axIs1182. | C. elegans | axIs1928 [mCherry::par-6]. axIs1182 [GFP::par-2]. Maintain at 25C to retain transgene expression. [NOTE: axIs1182 [GFP::par-2] might not be integrated; the CGC has received reports that it does not segregate to all progeny.] |
| JH2648 | unc-119(ed3) III; axIs1928. | C. elegans | axIs1928 [mCherry::par-6]. |
| JH2652 | ect-2(ax751) II; zuIs45 V. | C. elegans | zuIs45 [nmy-2::NMY-2::GFP + unc-119(+)] V. Temperature-sensitive Maternal-effect lethal at 25 C. Maintain at 15-20 C. |
| JH2657 | ect-2(ax751) II; axIs1928; axIs1182. | C. elegans | axIs1928 [mCherry::par-6]. axIs1182 [GFP::par-2]. Temperature-sensitive Maternal-effect lethal at 25 C. Maintain at 15-20 C. |
| JH2671 | unc-119(ed3) III; axIs1864. | C. elegans | axIs1864 [pie-1p::GFP::H2B::zim-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in mitotic germline; variable, sometimes weak, GFP expression in pachytene stage. |
| JH2686 | unc-119(ed3) III; axIs1844. | C. elegans | axIs1844 [GFP::npp-7 + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2688 | unc-119(ed3) III; axIs1927. | C. elegans | axIs1927 [LAPtag::glh-1 + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2691 | npp-10(ok467)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | C. elegans | qIs26 [lag-2::GFP + rol-6(su1006)]. ok467 deletion balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and npp-10 homozygotes (Emb or early Larval lethal). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. |
| JH2704 | unc-119(ed3) III; axIs1890. | C. elegans | axIs1890 [pie-1p::GFP::H2B::msh-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Weak GFP expression in mitotic germline; GFP expression in pachytene, oocytes, and embryos. |
| JH2730 | unc-119(ed3) III; axIs1895. | C. elegans | axIs1895 [pie-1p::GFP::H2B::rec-8 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos. |
| JH2749 | unc-119(ed3) III; axIs1914. | C. elegans | axIs1914 [syp-3p::GFP::syp-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in meiotic germline. |
| JH2754 | ect-2(ax751) II. | C. elegans | Temperature-sensitive Maternal-effect lethal at 25 C. Maintain at 15-20 C. |
| JH2756 | ect-2(ax751) II; par-3(it71) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; zuIs45 V. | C. elegans | zuIs45 [nmy-2::NMY-2::GFP + unc-119(+)] V. Temperature-sensitive. Maternal-effect lethal at 25 C. Maintain at 15-20 C. Segregates Unc Mel, non-Unc Mel, non-Unc Ste. Reference: Zonies S, et al. Development. 2010 May;137(10):1669-77. |
| JH2759 | unc-119(ed3) III; axIs1929. | C. elegans | axIs1929 [nmy-2::GFP + mCherry::par-2]. Reference: Zonies S, et al. Development. 2010 May;137(10):1669-77. |
| JH2773 | unc-119(ed3) III; axIs1946. | C. elegans | axIs1946 [pie-1p::Dendra::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2787 | pptr-1(tm3103) V. | C. elegans | pptr-1(tm3103) is a temperature-sensitive allele. Maintain at 15C. Fully penetrant P granule partitioning defect at 20-24C. Low penetrance of sterilty observed at 24-26C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2791 | pptr-1(tm3103) V; axIs1448. | C. elegans | axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2794 | pptr-1(tm3103) V; axIs1462. | C. elegans | axIs1462 [pie-1p::GFP::pie-1::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2800 | unc-119(ed3) III; axIs1964. | C. elegans | axIs1964 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2801 | unc-119(ed3) III; axIs1965. | C. elegans | axIs1965 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2802 | unc-119(ed3) III; axIs1950. | C. elegans | axIs1950 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2804 | unc-119(ed3) III; axIs1951. | C. elegans | axIs1951 [pie-1p::Dendra2::TEV::S-peptide::mex-5RR(S404A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2814 | unc-119(ed3) III; axIs1933. | C. elegans | axIs1933 [(pFM034) GFP::par-2 RNAi-resistant + unc-119(+)]. |
| JH2815 | unc-119(ed3) III; axIs1934. | C. elegans | axIs1934 [(pFM035) GFP::par-2 RNAi-resistant [R183-5A] + unc-119(+)]. |
| JH2816 | unc-119(ed3) III; axIs1935. | C. elegans | axIs1935 [(pFM036) GFP::par-2 RNAi-resistant [K162A] + unc-119(+)]. |
| JH2817 | unc-119(ed3) III; axIs1936. | C. elegans | axIs1936 [(pFM037) GFP::par-2 RNAi-resistant [R163A] + unc-119(+)]. |
| JH2825 | unc-119(ed3) III; axIs1943. | C. elegans | axIs1943 [(pFM050) mCherry::mlc-4 + unc-119(+)]. |
| JH2835 | pptr-1(tm3103) V; axIs1504. | C. elegans | axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2836 | unc-119(ed3) III; axIs????. | C. elegans | axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2839 | pptr-1(tm3103) V; axIs1522; axIs1929. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. axIs1929 [pie-1p::mCherry::par-2::pie-1 3'UTR + unc-119(+)]. Transgenes are prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2840 | unc-119(ed3) III; axIs???? ; axIs1731. | C. elegans | axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. axIs1731 [pie-1p::mCherry::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2841 | pptr-1(tm3103) V; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9. |
| JH2874 | pgl-1(ct131) him-3(e1147) III; ozIs5. | C. elegans | ozIs5 [gld-1::GFP + unc-119(+)]. |
| JH2877 | fbf-2(q738) II; pgl-1(ct131) him-3(e1147) III; axIs1722. | C. elegans | axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background. |
| JH2883 | fbf-1(ok91) II; pgl-1(ct131) him-3(e1147) III; axIs1722. | C. elegans | axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background. |
| JH2889 | unc-119(ed3) III; axIs1955. | C. elegans | axIs1955 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(S458A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2890 | unc-119(ed3) III; axIs1956. | C. elegans | axIs1956 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(R274E K318E)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. |
| JH2919 | unc-119(ed3) III; axIs2000. | C. elegans | axIs2000 [LAPtag::fbf-2::fbf-2 3'UTR]. Maintain at 25C to maintain transgene expression. |
| JH2929 | fbf-1(ok91) II; axIs2000. | C. elegans | axIs2000 [LAPtag::fbf-2::fbf-2 3'UTR]. Maintain at 25C to maintain transgene expression. |
| JH2932 | unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. | C. elegans | ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH2996 | cdc-37(ax2001) II; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH2997 | plk-1(ax2002) III; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH2998 | emb-30(ax2003) III; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH2999 | mbk-2(dd5ax2004) IV. | C. elegans | Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3000 | mbk-2(dd5ax2005) IV. | C. elegans | Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3002 | mbk-2(dd5ax2007) IV. | C. elegans | Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3003 | plk-1(ax2008) III; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3004 | tat-4(ax2009) II; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3005 | such-1(ax2010) III; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3006 | mus-101(ax2011) I; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3009 | fzy-1(ax2014) II; mbk-2(dd5) IV. | C. elegans | Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3011 | cdc-37(ax2001) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3012 | plk-1(ax2002) unc-119(ed3) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3013 | unc-119(ed3) orIs1 III; mbk-2(dd5ax2004) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3016 | unc-119(ed3) III; axIs2076. | C. elegans | axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3019 | unc-119(ed3) III; axIs2076; axIs2077. | C. elegans | axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. axIs2077 [pie-1p::GFP::pgl-3::pie-1 3'UTR]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3055 | meg-3(tm4259) X. | C. elegans | Mild embryonic P granule defect. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3064 | pptr-1(tm3103) V; axIs2076. | C. elegans | axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3075 | tat-4(ax2009) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3076 | unc-119(ed3) such-1(ax2010) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3078 | apc-1(ax2012) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Formerly known as mat-2. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3080 | fzy-1(ax2014) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3086 | emb-30(ax2003) unc-119(ed3) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3087 | xpo-2(ax2013) I; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. | C. elegans | orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41. |
| JH3134 | swan-1(ax2045[V5::swan-1]) V. | C. elegans | V5 tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3136 | swan-1(ax2047[Myc::swan-1]) V. | C. elegans | Myc tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3147 | ltIs37 IV; meg-3(tm4259) X; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3148 | ltIs37 IV; meg-1(vr10) X; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3149 | ltIs37 IV; meg-3(tm4259) meg-4(ax2026) X; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3150 | ltIs37 IV; meg-1(vr10) meg-3(tm4259) X; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3153 | meg-3(tm4259) X; axIs2076. | C. elegans | axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3155 | ltIs37 IV; pptr-1(tm3103) V; meg-3(tm4259) X; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3156 | ltIs37 IV; pptr-1(tm3103) V; meg-1(vr10) X; axIs1522. | C. elegans | axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3158 | swan-1&swan-2(ax2071) V. | C. elegans | Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801593-13807217) and insertion of ATTTGTTCAGACAATAAGCTNGAAATC. No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3159 | swan-1&swan-2(ax2072) V. | C. elegans | Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801629-13807223). No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3176 | gtbp-1(ax2029) IV. | C. elegans | Deletion/insertion (AGCTAGC) of a STOP codon/frameshift near the ATG between IV: 10128909...10128934. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3180 | nos-2(ax2033) II. | C. elegans | Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3182 | gtbp-1(ax2035[gtbp-1::TetraCys]) IV. | C. elegans | Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3184 | gtbp-1(ax2037([gtbp-1::Myc]) IV. | C. elegans | Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3186 | gtbp-1(ax2039[gtbp-1::3xFlag]) IV. | C. elegans | Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3188 | mex-5(ax2041[3xFLAG::mex-5]) IV. | C. elegans | Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3190 | mex-5(ax2043[OLLAS::mex-5]) IV. | C. elegans | Maintain at 20C. OLLAS-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3193 | nos-2(ax2049[3XFLAG::nos-2]) II. | C. elegans | Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3195 | mbk-2(ax2051[V5::mbk-2]) IV. | C. elegans | V5 tag inserted at the N-terminus of mbk-2 isoform a. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3197 | gtbp-1(ax2053[gtbp-1::GFP]) IV. | C. elegans | Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3199 | gtbp-1(ax2055[gtbp-1::GFP]) IV. | C. elegans | Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3201 | fbf-2(ax2057[fbf-2::GFP]) II. | C. elegans | Maintain at 20-25C. ax2057 was produced by mutation of the sgRNA site and insertion of GFP cDNA at the C-terminus of fbf-2. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of fbf-2: ATCATCGCCGTGACTACCA(GFP) between II:6089145...6089165. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3203 | mes-2(ax2059[mes-2::GFP]) II. | C. elegans | Maintain at 20C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of mes-2 between II:14388297...14388298. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3205 | lin-15B(ax2061[lin-15B::GFP]) X. | C. elegans | Maintain at 20C. Nuclear expression of lin-15B::GFP in oocytes and embryos. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3207 | deps-1(ax2063[deps-1::GFP]) I. | C. elegans | Maintain at 20C. GFP inserted at N-terminus of deps-1. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3209 | mex-6(ax2065[mex-6::GFP]) II. | C. elegans | GFP-tagged mex-6. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3212 | gtbp-1(ax2068) IV. | C. elegans | 1.6kb deletion in gtbp-1 between IV: 10127256...10128923. Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3215 | gtbp-1(ax2073) IV. | C. elegans | 1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| JH3225 | meg-3(tm4259) meg-4(ax2026) X. | C. elegans | P granule defect. High sterility. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3229 | meg-1(vr10) meg-3(tm4259) X. | C. elegans | P granule defect. Some sterility. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3230 | pgl-3(bn104) V; axIs2076. | C. elegans | axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3247 | meg-4(ax2080[meg-4::FLAG]) X. | C. elegans | C-terminal FLAG insertion in endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3248 | meg-4(ax2081) X. | C. elegans | Deletion removing 733 base pairs upstream of start and the first 2565 bases of the endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591. |
| JH3269 | pgl-1(ax3122[pgl-1::gfp]) IV. | C. elegans | GFP inserted at C terminus of endogenous pgl-1 locus. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226. |
| JH3296 | mex-5(ax3050[mCherry::mex-5]) IV. | C. elegans | mCherry tag inserted into endogenous mex-5 locus. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. |
| JH3308 | gtbp-1(ax5000[gtbp-1::tagRFP]) IV. | C elegans | tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687. |
| JH3379 | meg-1(ax4534[meg-1::gfp]) X. | C. elegans | GFP tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602. |
| JH3407 | meg-1(ax4535[meg-1::OLLAS]) X. | C. elegans | OLLAS tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602. |
| JH3475 | meg-3(ax3055) meg-4(ax3052) X. | C. elegans | Embryonic P granules not segregated, 30% maternal effect sterility on average, RNAi insensitivity. meg-3(ax3055) and meg-4(ax3052) are precise deletions of the entire coding sequence made by CRISPR/Cas9, designed to be cut again to make insertions at the endogenous locus. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283 |
| JH3477 | meg-3(ax3051[meg-3::OLLAS]) meg-4(ax3052) X. | C. elegans | P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570. |
| JH3503 | meg-3(ax3054[meg-3::meGFP]) X. | C. elegans | meGFP inserted between P121 and V122 of endogenous MEG-3. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226. Smith et al. Elife. 2016 Dec 3;5. pii: e21337. |
| JH3553 | meg-3(ax4503[del(1-544)::OLLAS]) meg-4(ax4504) X. | C. elegans | Description: 20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (1-544); MEG-3 does not form a cytoplasmic gradient but does still form granules in early embryos and co-localizes with PGL-3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570. |
| JH3562 | gtbp-1(ax5000[gtbp-1::tagRFP]) IV; meg-3(ax3054[meg-3::meGFP]) X. | C. elegans | tagRFP tag inserted into endogenous gtbp-1 locus. meGFP tag inserted between P121 and V122 of endogenous MEG-3. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687. |
| JH3571 | mut-16(ax4313[mut-16::meGFP]) I. | C. elegans | meGFP tag inserted at C-terminus of endogenous mut-16 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline." |
| JH3614 | par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X. | C. elegans | meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118 |
| JH3616 | par-1(ax4206[par-1::meGFP]) V. | C. elegans | meGFP tag inserted at C-terminus of endogenous par-1 locus. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118 |
| JH3619 | par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). | C.elegans | qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118 |
| JH3644 | fog-2(q71) V; meg-3(ax4320[meg-3::mCherry]) X. | C. elegans | mCherry inserted at C terminus of endogenous meg-3 locus. fog-2(q71) is male/female strain. Maintain by mating. XX animals are female. XO animals are WT males. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226. |
| JH3657 | pgl-3(ax4300[pgl-3::mCherry]) fog-2(q71) V. | C. elegans | mCherry inserted at C terminus of endogenous pgl-3 locus. fog-2(q71) is male/female strain. Maintain by mating. XX animals are female. XO animals are WT males. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226. |
| JH3678 | mex-5(ax3050[mCherry::mex-5])/nT1[qIs51] IV; par-1(ax4209[par-1(T983A)::meGFP])/nT1[qIs51] V. | C. elegans | qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118. |
| JH3679 | mex-5(ax3050[mCherry::mex-5]) IV; par-1(ax4206[par-1::meGFP]) V. | C. elegans | qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Homozygous mex-5(ax3050[mCherry::mex-5]); par-1(ax4206[par-1::meGFP]) animals are fully viable and fertile. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118. |
| JH3861 | meg-3(ax4502[meg-3(F705A,Y708A,Y713A, N725A)::OLLAS]) meg-4(ax3052) X. | C. elegans | 20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570. |
| JH3867 | bqSi189 II; npp-10(ax4538[mNeonGreen::npp-10]) III. | C. elegans | bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-10 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3872 | npp-14(ax4548[npp-14::OLLAS]) I. | C. elegans | OLLAS is inserted at the C-terminus of the endogenous npp-14 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3886 | npp-14(ax4543) I. | C. elegans | ax4523 is a deletion residues 24-1387 of the npp-14 coding region. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3904 | tdp-1(ax4546[tdp-1::wrmScarlet]) II. | C. elegans | wrmScarlet is inserted at the C-terminus of the endogenous tdp-1 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3906 | ran-2(ax4545[ran-2::wrmScarlet]) III. | C. elegans | wrmScarlet is inserted at the C-terminus of the endogenous ran-2 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3929 | pos-1(tn1730[gfp::3xflag::pos-1]) V; meg-3(ax3055) meg-4(ax3052) X. | C. elegans | Allows visualization of POS-1 protein in the absence of embryonic P granules. Derived by crossing parental strains DG4222 and JH3475. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH3938 | bqSi189 II; npp-9(ax4540[mNeonGreen::npp-9]) III. | C. elegans | bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the N-terminus of the endogenous npp-9 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH3944 | npp-12(ax4544) I. | C. elegans | ax4544 is a CRISPR-engineered null mutant of npp-12. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline." |
| JH3955 | bqSi189 II; xpo-1(ax4542[xpo-1::mNeonGreen]) V. | C. elegans | bqSi189 [lmn-1p::mCherry::his-58::pie-1 3'utr] II. mNeonGreen is inserted at the C-terminus of the endogenous xpo-1 locus. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH4008 | htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. | C. elegans | Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54. |
| JH4012 | gtbp-1(ax4561[gtbp-1p::IBB domain::mNeonGreen::gtbp-1 3'utr]) IV. | C. elegans | The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH4072 | pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. | C. elegans | 3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w. |
| JH4073 | pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. | C. elegans | 3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w. |
| JH4201 | npp-11(ax4547[npp-11::wrmScarlet]) I. | C. elegans | wrmScarlet is inserted at the C-terminus of the endogenous npp-11 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH4202 | npp-22(ax4549[npp-22::wrmScarlet]) V. | C. elegans | wrmScarlet is inserted at the C-terminus of the endogenous npp-22 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans |
| JH4410 | ifet-1(ax4582[ifet-1::3xHA]) III. | C. elegans | 3xHA tag inserted at C-terminus of endogenous ifet-1 locus. CRISPR Guide sequence: ttaaacccatatttCTACTT. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH4416 | npp-12(ax4539[npp-12::mNeonGreen]) I. | C. elegans | mNeonGreen tag inserted at the C-terminus of the endogenous npp-12 locus. Reference: Thomas L, et al. EMBO J. 2023 Jul 3;42(13):e112987. doi: 10.15252/embj.2022112987. PMID: 37254647. |
| JH4467 | npp-14(syb8024[npp-14::mNeonGreen]) I. | C. elegans | mNeonGreen tag inserted at the C-terminus of the endogenous npp-14 locus. NPP-14::mNeonGreen is expressed in all tissues. Reference: Thomas L, et al. Development. 2025 Mar 15;152(6):dev204585. doi: 10.1242/dev.204585. PMID: 40067309. |
| JH4473 | imb-1(syb8052[mNeonGreen::imb-1]) I. | C. elegans | mNeonGreen tag inserted at N-terminus of endogenous imb-1 locus. Expressed in all tissues. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline." |
| JH4476 | nucl-1(syb8070[nucl-1::wrmScarlet]) IV. | C. elegans | wrmScarlet tag inserted at C-terminus of endogenous nucl-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline." |
| JH4484 | npp-11(4585[npp-11::AID*::3xFLAG]) I. | C. elegans | AID*::3xFLAG tags inserted at C-terminus of endogenous npp-11 locus. AID* is a minimal AID construct of 44 amino acids (https://academic.oup.com/genetics/article/217/3/iyab006/6104563). Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline." |
| JH4504 | glh-1(ax4587[glh-1(del18-236) I. | C. elegans | ax4587 is a CRISPR-engineered deletion removing the FGG repeats of GLH-1. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline." |
| JH4804 | ccf-1(ax4572[ccf-1::Spot-tag]) III. | C. elegans | Spot-tag inserted at C-terminus of endogenous ccf-1 locus. CRISPR Guide sequence: GGAACTCCGATTAGGCCTTG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH4816 | car-1(syb8217[car-1::wrmScarlet] I. | C. elegans | wrmScarlet tag inserted at C-terminus of endogenous car-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline." |
| JH4852 | zif-1(egx157[7xHA::zif-1]) III. | C. elegans | 7xHA tag inserted at N-terminus of endogenous zif-1 locus. NOTE: egx157 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. CRISPR Guide sequence: ATATGTATCTAATTACAGAG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH4876 | nos-2(egx211[7xHA::nos-2]) II. | C. elegans | 7xHA tag inserted at N-terminus of endogenous nos-2 locus. NOTE: egx211 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. CRISPR Guide sequence: TTCTTCTTGAAAGATGTCTC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH4877 | nos-2(egx211[7xHA::nos-2]) II; meg-1(vr10) X. | C. elegans | 7xHA tag inserted at N-terminus of endogenous nos-2 locus. Minor maternal effect sterility at 20C; increased sterility at 25C. Derived by crossing parental strains YL139 and JH4876. NOTE: egx211 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. egx211 CRISPR Guide sequence: TTCTTCTTGAAAGATGTCTC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH4878 | nos-2(egx211[7xHA::nos-2]) II; meg-3(ax3055) meg-4(ax3052) X. | C. elegans | 7xHA tag inserted at N-terminus of endogenous nos-2 locus. Embryonic P granules fail to segregate. 30% maternal effect sterility on average. RNAi insensitivity. Derived by crossing parental strains JH3475 and JH4876. NOTE: egx211 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. egx211 CRISPR Guide sequence: TTCTTCTTGAAAGATGTCTC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH4940 | xnd-1(ax4606[8xAlfa-Tag::xnd-1]) III. | C. elegans | 8xAlfa-Tag inserted at N-terminus of endogenous xnd-1 locus. CRISPR Guide sequence: AATGGGTTCAGAAGACATCC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH5098 | xnd-1(ax4606[8xAlfa-Tag::xnd-1]) III; meg-3(ax3055) meg-4(ax3052) X. | C. elegans | 8xAlfa-Tag inserted at N-terminus of endogenous xnd-1 locus. Embryonic P granules fail to segregate. 30% maternal effect sterility on average. RNAi insensitivity. Derived by crossing parental strains JH3475 and JH4940. ax4606 CRISPR Guide sequence: AATGGGTTCAGAAGACATCC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH5284 | glh-1(sam24[glh-1::GFP::3xFLAG) rps-6(rns6[rps-6::mCherry]) I. | C. elegans | GFP::3xFlag tags inserted at C-terminus of endogenous glh-1 locus. mCherry tag inserted at C-terminus of endogenous rps-6 locus. Dual fluorescent tags allow visualization of ribosomes and germ granules. Derived by crossing parental strains DUP64 and JAR16. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| JH5286 | glh-1(ust406[mCherry::glh-1]) I; eif-1.A(qy90[eif-1.A::mNG]) IV. | C. elegans | mCherry tag inserted at N-terminus of endogenous glh-1 locus. mNG tag inserted at C-terminus of endogenous eif-1.A locus. Dual fluorescent tags allow simultaneous visualization of ribosomes and germ granules. Derived by crossing parental strains SHG2848 and NK2621. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| KK866 | itIs153. | C. elegans | itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. itIs153 is an integrated derivitive of axEx1094. |
| PHX8273 | dcap-1(syb8273[HA::dcap-1]) IV. | C. elegans | HA tag inserted at N-terminus of endogenous dcap-1 locus. CRISPR Guide sequence: aaaactcaacattttcatcc. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX8426 | dcap-2(syb8426[dcap-2::Spot-tag]) IV. | C. elegans | Superficially wild-type. Spot-tag inserted at the C-terminus of the endogenous dcap-2 locus. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9016 | gld-2(syb9016[mNG::gld-2a]) I. | C. elegans | mNeonGreen tag inserted at N-terminus of endogenous gld-2 locus tags only long (A) isoform of GLD-2. CRISPR Guide sequence: ttttgtcgccaatATGGTTA. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9021 | ifg-1(syb9021[ifg-1::mNG]) II. | C. elegans | mNeonGreen tag inserted at C-terminus of endogenous ifg-1 locus. CRISPR Guide sequence: ACGTTGTCGAGCTATTTGAC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9249 | eif-3.b(syb9249[eif-3.b::wrmScarlett]) II. | C. elegans | wrmScarlett tag inserted into endogenous eif-3.d locus. CRISPR Guide sequence: ACAAGCCCCTCTGACGGAGG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9252 | eif-3.d(syb9252[eif-3.d::AID*::3xFLAG::mNeonGreen]) III. | C. elegans | AID*::3xFlag::mNG tags inserted into C-terminus of endogenous eif-3.d locus. CRISPR Guide sequence: ATGACGATCAATAAagtccc. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9257 | iffb-1(syb9257[iffb-1::linker::sfGFP]) III. | C. elegans | sfGFP tag with linker inserted at C-terminus of endogenous iffb-1 locus. CRISPR Guide sequence: TTCTTCGGCGGCATtttcgg. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9283 | eif-2alpha(syb9283[eif-2alpha::linker::sfGFP]) I. | C. elegans | sfGFP tag with linker inserted at C-terminus of endogenous eif-2alpha locus. CRISPR Guide sequence: CGATGAAGACAGTGATGAGG. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9379 | inf-1(syb9379[eGFP::linker::inf-1]) III. | C. elegans | eGFP tag with linker inserted at N-terminus of endogenous inf-1 locus. CRISPR Guide sequence: GTTCACATCATTTTTAACAT. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
| PHX9406 | iff-2(syb9406[mNG::linker::iff-2]) II. | C. elegans | mNeonGreen tag with linker inserted at N-terminus of endogenous iff-2 locus. CRISPR Guide sequence: GTGATGATCGTCAGACATat. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| ax68 | Allele | substitution | |
| ax161 | Allele | substitution | |
| ax144 | Allele | substitution | |
| ax81 | Allele | ||
| ax76 | Allele | substitution | |
| ax102 | Allele | substitution | |
| ax224 | Allele | substitution | |
| ax751 | Allele | substitution | |
| ax2001 | substitution | ||
| ax2002 | substitution | ||
| ax2003 | |||
| ax2004 | substitution | ||
| ax2005 | substitution | ||
| ax2007 | substitution | ||
| ax2008 | substitution | ||
| ax2009 | substitution | ||
| ax2010 | substitution | ||
| ax2011 | substitution | ||
| ax2014 | substitution | ||
| ax2012 | substitution | ||
| ax2013 | substitution | ||
| ax2071 | Allele | deletion | |
| ax2072 | Allele | deletion | |
| ax2029 | Allele | substitution | |
| ax2033 | Allele | substitution | |
| ax2068 | Allele | deletion | |
| ax2073 | Allele | insertion | |
| ax701 | Allele | substitution | |
| ax514 | Allele | substitution |