Caenorhabditis Genetics Center (CGC)

Laboratory Information

NameEU View on WormBase
Allele designationor
HeadBruce Alan Bowerman
InstitutionUniversity of Oregon, Eugene
Address 1229 University of Oregon
1318 Franklin Boulevard
Room 273 Onyx Bdge
Eugene 97403-1229
United States
Website http://molbio.uoregon.edu
Gene classes ccd  cen  cow  cyk  dcn  div  dlc  efa  farl  gsk  mop  pfn  repo  rfl 
scu  ippk 

Strains contributed by this laboratory

Strain Genotype Species Description
EU1006 dnc-1(or404) IV. C. elegans Temperature sensitive. At 15C, 100% viable. At 26C, 2% viable. At 25C, 10% viable. Missense mutation R to C at position 1237 (nucleotide #3709: cgt to tgt). Reduced brood size after upshift. Received new stock 12/04.
EU1007 mel-26(or543) I. C. elegans Temperature sensitive. Maintain at 15C. At 25C, hermaphrodites lay embryos that die. Transverse PO mitotic spindle, cytokinesis defects. Missense mutation at nucleotide #379 (cyt->tgt); amino acid #127 (R to C).
EU1008 apo-5(or358) I. C. elegans Temperature sensitive, embryonic lethal mutant. 98% of embryos produced by homoygous mothers hatch at 15C; 0% produced at 26C hatch (but some viability at 25C). Mutation is recessive at 26C. First mitotic spindle in one-cell zygote is mis-positioned, often abnormally near the posterior pole; some chromosome segregation defects.
EU1062 sur-6(or550) I. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1065 unc-119(ed3) III; orIs1. C. elegans Appears WT. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 20C or above. Below 20C the GFP signal turns off.
EU1068 unc-119(ed3) ruIs32 III; repo-1 (or430) IV; ruIs57. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EU1073 him-8(e1489) IV; act-2(or295) V. C. elegans Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. Throws males. or295 is a gga to aga substitution (G16R).
EU1074 gpr-1(or574) III. C. elegans Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Embryonic lethal at restrictive temperature of 26C; viable embryos at permissive temperature of 15C. [NOTE: PCR detection of or574 can be difficult. gpr-1 and gpr-2 paralogues are closely linked and 97% identical in DNA sequence.] Reference: Couwenbergs C, et al. J Cell Biol. 2007 Oct 8;179(1):15-22.
EU1077 mel-26(or543) I; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C. At 25C, hermaphrodites lay embryos that die. Transverse PO mitotic spindle, cytokinesis defects. Missense mutation at nucleotide #379 (cyt->tgt); amino acid #127 (R to C). Throws males.
EU1133 apo-5(or358) ruIs32 III C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. apo-5(or358) is temperature-sensitive embryonic lethal. 100% dead embryos when L4 larvae are shifted to 26.6C. A small percentage of embryos survive form L4 larvae shifted to 25-26C. or358 appears to be semi-dominant; L4 or358/+ heterozygotes shifted to 26C produce ~20% embryonic lethality. Maintain at 15C. References: Encalada SE, et al., Mol Biol Cell. 2005 Mar;16(3):1056-70. Strome S, et al. Mol Biol Cell. 2001 Jun;12(6):1751-64.
EU1135 tba-1(or346) I. C. elegans Dominant, conditional, maternal-effect. At 15C, almost all embryos hatch from or346/+ and or346/or346 mothers. At25C, about 85% of embryos die from or346/+ mothers and about 100% of embryos die from or346/or346 mothers.
EU1161 tba-1(or594) I. C. elegans Semi-dominant. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1257 dnc-1(or676) IV. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1295 act-2(or621) V. C. elegans Strongly semi-dominant, temperature sensitive, embryonic lethal mutant. 40% of embyros produced by homozygous mothers at 15C will hatch; 0% produced at 26C will hatch. Mutation is semi-dominant at 26C: 85% of embyros produced by heterozygous mothers hatched at 26C. Mutant embryos exhibit excess coritical actomyosin contractility (extra furrows and protrusions) in early embryonic cells; during interphase and most of mitosis. or621 is a tcc to gcc substitution (S15A).
EU1296 him-8(e1489) IV; act-2(or621) V. C. elegans Strongly semi-dominant, temperature sensitive, embryonic lethal mutant. 40% of embyros produced by homozygous mothers at 15C will hatch; 0% produced at 26C will hatch. Mutation is semi-dominant at 26C: 85% of embyros produced by heterozygous mothers hatched at 26C. Mutant embryos exhibit excess coritical actomyosin contractility (extra furrows and protrusions) in early embryonic cells; during interphase and most of mitosis. Throws males. or621 is a tcc to gcc substitution (S15A).
EU1303 cyk-4(or570) III. C elegans Maintain at 15C. Temperature-sensitive embryonic lethal with cytokinesis defects. Reference: Canman JC, et al. Science. 2008 Dec 5;322(5907):1543-6.
EU1327 par-2(or640) III. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1347 spd-2(or655) I. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1381 act-2(or295) V. C. elegans Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. or295 is a gga to aga substitution (G16R).
EU1382 orEx1. C. elegans orEx1[act-2 promoter::GFP::act-2 genomic fusion + rol-6(su1006)]. Shows cytoplasmic and cortical ACT-2::GFP expression in early embryonic cells, in epidermal cells during embryonic elongation, and in body wall muscle cells and some neurons in adults. All expression is zygotic; no germline expression is detected for this trangene even though act-2 is maternally expressed. Maintain by picking Rollers.
EU1383 act-2(ok1229) V. C. elegans Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exn and extending beyond the 3' UTR.
EU1385 dhc-1(or283ts) C. elegans Temperature-sensitive embryonic lethal. 100% dead embryos at 25 degrees. Maintain at 15 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.
EU1386 dhc-1(or352ts) C. elegans Temperature-sensitive embryonic lethal. 100% dead embryos at 25 degrees. Maintain at 15 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.
EU139 skn-1(or12) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc. Received new stock 11/2002.
EU1404 cyk-4(or749) III. C. elegans Temperature-sensitive Sterile and Embryonic lethal. Maintain at 15C. Homozygous or749 L4 larvae shifted to 25C become fertile adults that produce embryos with a late cytokinesis defect after the first embryonic mitosis. Reference: Canman JC, et al. Science. 2008 Dec 5;322(5907):1543-6.
EU1424 mom-2(or77) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans mom-2(or77) is a recessive, non-conditional maternal-effect embryonic lethal. Weak allele of mom-2/Wnt (splice acceptor mutation in last exon (exon6). 8% of mutant embryos lack gut. Heterozygotes are Unc.
EU143 skn-1(or13) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.
EU1441 plk-1(or683) III. C. elegans Temperature sensitive embryonic lethal/sterile. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1444 unc-119(ed3) III; orIs17. C. elegans orIs17 [dhc-1p::GFP::dhc-1 + unc-119(+)]. N-terminal-tagged GFP::dhc-1 fusion driven by the dhc-1 promoter. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.
EU1446 unc-119(ed3) III; orIs14. C. elegans orIs14 [pie-1p::GFP::efa-6c::pie-1 3'UTR + unc-119(+)]. pie-1 promoter-driven N-terminal GFP fusion to EFA-6 isoform C. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.
EU1449 unc-119(ed3) III; orIs19. C. elegans orIs19 [pie-1::GFP::dylt-1 + unc-119(+)]. Superficially wild-type. Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.
EU1472 let-99(or204) IV; him-5(e1490) V. C. elegans let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.
EU148 apx-1(or15) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.
EU1481 orIs20. C. elegans orIs20 [pie-1p::GFP::MOE]. Maintain under normal conditions.
EU1485 ltIs37 IV; orIs13. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs13 [pie-1p::GFP::npp-22(genomic)::pie-1 3'UTR + unc-119(+)]. GFP-tagged NPP-22. Superficially wild-type. Might still carry unc-119(ed3) in background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.
EU149 mex-3(or20)/hT1 I; +/hT1 V; lin-2(e1309) X. C. elegans Strain is egg-laying defective. Homozygous mex-3(or20) is a non-conditional maternal effect lethal: worms fill up with dead eggs. Heterozygotes bag with 11/16 dead embryos and larvae. About 10% of worms can lay eggs and be mated into for outcrossing. The mex-3(or20) mutant embryos produce excess body wall muscle anteriorly.
EU1506 dnc-4(or633) IV. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1513 aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; lin-2(e1309) X. C. elegans or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. or28 is a G to D mis-sense mutation at amino acid position 123.
EU1514 aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV; lin-2(e1309) X. C. elegans or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. Strain produces a lot of males due to him-8(ec56). or28 is a G to D mis-sense mutation at amino acid position 123.
EU1515 aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV. C. elegans Him. or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123.
EU1516 aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).
EU1588 tbb-2(or600) III. C. elegans Semi-dominant. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1590 zyg-12(or577) II. C. elegans Recessive, temperature-sensitive embryonic lethal mutant . Maintain at 15C, most embryos will hatch. Nearly all embryos fail to hatch at 25C. Centrosomes are detached from nuclear spindle envelope in one-cell stage embryos; sometimes reattach to pronuclei; sometimes stay unattached throughout prophase until nuclear envelope breakdown. Mis-sense mutation in Q367P. Hook family member. Localizes to nuclear envelope and centrosomes; interacts with SUN domain proteins at nuclear envelope and interacts with dynein.
EU1592 aspm-1(or645) I. C. elegans Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
EU16 dpy-18(e364) pie-1(zu154) III; skn-1(zu67)/nT1 [unc-?(n754) let-?] IV; +/nT1 V; eDp6 (III;f). C. elegans Heterozygotes are Unc. Segregates Uncs (dpy-18 pie-1; skn-1/DnT1; eDp6), Dpy non-Uncs (dpy-18 pie-1; skn-1 with no Dp) which give only dead embryos, and DpyUncs (dpy-18 pie-1; skn-1/DnT1 with no Dp) which give only dead eggs, WT looking (dpy-18 pie-1; skn-1; eDp6) which give only dead embryos, and dead eggs.
EU1600 aspm-1(or645); ltIs37 IV; ojIs1. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive. Viable at 15C. Complete loss of aspm-1 function at 26C. Shift to restrictive temperature for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311. PMID: 24554763
EU1617 unc-119(ed3) III; orEx15. C. elegans orEx15 [pie-1p::GFP::rfl-1(genomic) + unc-119(+)]. Pick non-Unc to maintain. pie-1 promoter-driven N-terminal GFP fusion to RFL-1. Reference: Dorfman M, et al. Genetics. 2009 Aug;182(4):1035-49.
EU1618 unc-119(ed3) III; orEx16. C. elegans orEx16 [rfl-1p::tdTomato::rfl-1(genomic) + unc-119(+)]. Pick non-Unc to maintain. N-terminal tdTomato fusion to RFL-1 driven by rfl-1 promoter. Reference: Dorfman M, et al. Genetics. 2009 Aug;182(4):1035-49.
EU176 apx-1(or22) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.
EU2005 spd-2(or493) I. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU2008 zyg-1(or1018) II. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU2009 zyg-1(or409) II. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU2010 spd-2(or454) I. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU2470 unc-119(ed3) III; orEx25. C. elegans orEx25 [GFP::aspm-1 + unc-119(+)]. Maintain at 25C. Pick non-Unc GFP+ to maintain. GFP might not be visible at low magnification. Reference: Connolly AA, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
EU2695 klp-7(or1292) III; ltIs37 IV; ojIs1. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2697 mei-1(or1178) I; ItIs37 IV; ojIs1. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
EU2706 unc-119(ed3) ruIs32 III; drp-1(or1393) IV. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2711 ndg-4(or1565) unc-119(ed3) ruIs32 III; ojIs1. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2715 klp-7(or1092) III; ltIs37 IV; ojIs1. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2836 unc-32(e189) sas-7(or452) / qC1[dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregates WT, Sterile Dpys, and Unc. Unc worms produce temperature sensitive lethal embryos with centriole duplication defects. Keep at 15˚C to maintain or452 homozygotes. Ref. Sugioka, Hamill, et al., (2016) eLife 6 e20353.
EU2858 repo-1(or430) IV; itIs153; ojIs1. C. elegans itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EU2861 aspm-1(or1935[GFP::aspm-1]) I. C. elegans GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2863 klp-7(or1092) III. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2866 ltIs37 IV; orIs1. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 25C to retain transgene fluorescence. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2876 aspm-1(or1935[GFP::aspm-1]) I; ltIs37 IV. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2882 ndg-4(or1439) unc-119(ed3) ruIs32 III; ojIs1. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2883 abtm-1(or891) I; unc-119(ed3) ruIs32 III; ojIs1. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2884 atx-2(or821) unc-119(ed3) III; orIs21. C. elegans orIs21 [pie-1p::GFP::PH]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2885 abtm-1(or983) I; unc-119(ed3) ruIs32 III; ojIs1. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2887 abtm-1(or1613) I; unc-119(ed3) ruIs32 III; ojIs1; orIs21. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. orIs21 [pie-1p::GFP::PH]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2890 abtm-1(or1400) I; unc-119(ed3) ruIs32 III. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2891 abtm-1(or1184) I; unc-119(ed3) ruIs32 III; ojIs1; orIs21. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. orIs21 [pie-1p::GFP::PH]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2892 ndg-4(or1088) unc-119(ed3) ruIs32 III. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2893 unc-119(ed3) ruIs32 III; drp-1(or1233) IV; ojIs1; orIs21. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. orIs21 [pie-1p::GFP::PH]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2896 rpl-7(or1247) I; unc-119(ed3) ruIs32 III. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2902 rpl-7(or990) I; unc-119(ed3) ruIs32 III. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2906 sqv-8(or1112) II; unc-119(ed3) ruIs32 III; ojIs1; orIs21. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. orIs21 [pie-1p::GFP::PH]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2908 ippk-1(or1572) II; unc-119(ed3) ruIs32 III. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2914 sqv-8(or888) II; unc-119(ed3) ruIs32 III. C. elegans ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2917 drp-1(or1941[drp-1::GFP]) IV. C. elegans Endogenous drp-1 locus tagged with GFP using CRISPR/Cas9. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2934 aspm-1(or1935[GFP::aspm-1]) I; klp-7(or1292) III; itIs37 IV. C. elegans itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2936 unc-69(e587) klp-7(or1092) III. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2959 vps-15(or1235ts) II; unc-119(ed3) III; orIs21. C. elegans orIs21 [pie-1p::GFP::PH]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2960 crn-3(or959ts) II; ojIs1 IV. C. elegans ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)] IV. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU3000 sas-7(or1940[gfp::sas-7]) III; ltIs37 IV. C. elegans sas-7(or1940[gfp::sas-7]) III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Green centriole signal and red chromosome signal. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Sugioka, et al., 2017 Elife 6 e20353.
EU3020 cls-2(or1948)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
EU3023 cls-2(or1951)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. C. elegans qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
EU3030 ijmSi3 I; unc-119(ed3) III; ltIs37 IV. C elegans ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.
EU3068 ebp-2(or1954[ebp-2::mKate2]) II; ruIs57. C. elegans ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Superficially wild-type. mKate2 was inserted into the C-terminus of ebp-2 endogenous locus. Reference: Sugioka K, et al. (2018) PNAS, Jan 30;115(5): E954-E963. (PubMed ID: 29348204)
EU307 +/szT1 [lon-2(e678)] I; mom-1(or46) dpy-6(e14)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or46.
EU308 +/szT1 [lon-2(e678)] I; mom-1(or10) dpy-6(e14)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or10.
EU3095 aspm-1(or1935[GFP::aspm-1]) I; zyg-9(or1984) II; ltIs37 IV. C elegans ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 15C. Fast-acting temperature-sensitive allele. At restrictive temperature (26C), animals give rise to 100% dead embryos. At 15C, animals give rise to viable progeny. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Might still carry unc-119(ed3) III in background. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115
EU31 skn-1(zu135) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.
EU311 dpy-5(e61) mom-5(or57)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozygotes are WT and segregate WT, Dpys and dead eggs. Dpys give only embryonic lethals which lack endoderm and make excess mesoderm. or57 is a recessive maternal-effect lethal.
EU3115 klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57. C elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3121 tac-1(or1955[gfp::tac-1]) II; ltIs37 IV. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous tac-1 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3169 zyg-9(or1956[gfp::zyg-9]) II; ltIs37 IV. C. elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3201 klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV C elegans ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU3206 sas-6(or1167) IV. C elegans Temperature-sensitive embryonic lethal. Maintain at 15C with 20% to 50% hatching rate. 100% lethality and mono-polar spindle at 26C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU3407 zyg-9(or1985)/mnC1[dpy-10(e128) unc-52(e444) umnIs32] II. C elegans umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115
EU35 skn-1(zu169) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.
EU361 +/szT1 [lon-2(e678)] I; mom-1(or10) unc-6(n102)/szT1 X. C. elegans Heterozygotes are WT and segregate WT, Uncs with a protruding vulva, Long males and dead eggs. Uncs give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or10 is a recessive maternal-effect embryonic lethal. Zygotic phenotype of or10 is protruding vulva and slight uncoordination.
EU363 let-99(or81) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc.
EU365 mom-2(or85) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]
EU367 glp-1(e2141) III; mom-2(or42) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Maintain at 15C. Animals are Unc.
EU370 spn-4(or25) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.
EU384 dpy-11(e1180) mom-2(or42) V/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Dpys and dead eggs. Dpys segregate only embryonic lethals which lack endoderm and make excess mesoderm with E adopting and MS-like fate. or42 is a recessive maternal-effect lethal.
EU396 cyk-1(or36) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs.
EU40 skn-1(zu129) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.
EU404 rol-1(e91) mig-14(or78)/mnC1 [dpy-10(e128) unc-52(e444)] II. C. elegans Heterozygotes are WT and segregate WT, Uncs and Rollers. or78 zygotic effects: Pv, mild Unc, many explode at vulva upon reaching adulthood. or78 maternal effects: endoderm (E) transformed into mesoderm (MS) in early embryo, severe morphogenesis defect. mig-14, mom-3, pvl-2, and let-553 are the same gene.
EU407 mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(e1489) IV; lin-2(e1309) X. C. elegans
EU41 skn-1(or19) IV/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.
EU414 unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal.
EU415 cyk-1(or36) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-8(e1489) IV. C. elegans Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs at all temperatures. Throws males.
EU417 mom-2(or33) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans mom-2(or33) is a recessive, non-conditional maternal-effect embryonic lethal. Intermediate strength allele; missense mutation near C-terminus: C321Y. 50% of mutant embryos lack gut. Heterozygotes are Unc.
EU423 dpy-5(e61) mom-4(or39)/hT1 I; mom-2(or42) unc-42(e270)/hT1 V. C. elegans Heterozygotes are WT.
EU443 unc-13(e1091) mom-4(or11)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or11 is a recessive maternal-effect embryonic lethal.
EU446 unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal.
EU447 unc-13(e1091) mom-4(or39)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(e1489) IV. C. elegans Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal. Throws males.
EU452 mom-5(zu193) unc-13(e1091)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozgyotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.
EU459 unc-13(e1091) mom-5(zu193)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV. C. elegans Heterozygotes are WT and segregate WT and Uncs. The Uncs have a non-conditional maternal-effect embryonic lethal phenotype: the E blastomere adopts MS fate in about 5% of mutant embryos. The Uncs are 100% penetrant for embyronic lethality and morphogenesis defects.
EU548 div-1(or148) III. C. elegans Temperature sensitive. Maintain at 15C.
EU550 div-1(or148) III; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU552 glp-1(or178) III. C. elegans Temperature sensitive. At 25C: Ste, during embryogenesis. Strong embryonic phenotype (anterior pharynx missing, no morophogenesis) if shifted during adulthood.
EU554 zen-4(or153) IV. C. elegans Temperature sensitive. Grow at permissive temperature of 15C. Fully penetrant cytokinesis defect at the restrictive temperature of 25C.
EU558 spd-2(or183) I. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU573 orEx2. C. elegans orEx2 [mlc-4p::mlc-4(genomic coding)::GFP::unc-54 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. Rollers are GFP+.
EU588 him-8(e1489) IV; spn-4(or191) V. C. elegans Temperature sensitive. Viable at 15C; lethal at 25C. At 25C, embryos exhibit defects in spindle orientation and cell fate patterning. Throws males.
EU591 dpy-13(e184) zen-4(or153) IV. C. elegans Temperature sensitive. Grow at permissive temperature of 15C. Fully penetrant cytokinesis defect at the restrictive temperature of 25C. Semi-dominant Dpy.
EU592 unc-8(n491) zen-4(or153) IV. C. elegans Temperature sensitive. Grow at permissive temperature of 15C. Fully penetrant cytokinesis defect at the restrictive temperature of 25C. Semi-dominant Unc.
EU593 mel-26(or184) I. C. elegans Temperature sensitive. Maintain at 15C. At 25C, hermaphrodites lay embryos that die. Transverse PO mitotic spindle, cytokinesis defects. Missense mutation at nucleotide #245 (gga->gaa); amino acid #82 (G to E).
EU603 lit-1(or131) III; him-8(e1489) IV. C. elegans or131 mutant embyros have a highly penetrant mom-like defect with mutant embryos lacking gut and making extra pharyngeal tissue at 25C. Maintain at 15C.
EU618 mlc-4(or253)/qC1 [dpy-19(e1259) glp-1(q339)] III. C. elegans Heterozygotes are WT and segregate WT, DpySteriles and late embryonic or early larval lethals with incomplete elongation/morphogenesis.
EU626 rfl-1(or198) III. C. elegans Temperature sensitive maternal effect lethal mutation in F11H8.1 (Nedd8 activating enzyme). Permissive temperature is 15C, restrictive temperature is 25C. Embryos layed at restrictive temperature have spindle-orientation defects due to the mis-localization of MEI-1/MEI-2 to the mitotic spindle. Additionally, ectopic cleavage furrows are initiated during cytokinesis, and cell-cycle delays are apparent during interphase.
EU630 air-2(or207) I. C. elegans Temperature sensitive. Grow at permissive temperature of 15C. Fully penetrant cytokinesis defect at the restrictive temperature of 25C.
EU640 cul-2(or209) III. C. elegans Temperature sensitive. Maintain at 15C.
EU641 cul-2(or209) III; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU704 zyg-1(or278) II. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU707 air-2(or207) unc-13(e51) I. C. elegans Temperature sensitive. Grow at permissive temperature of 15C. Fully penetrant cytokinesis defect at the restrictive temperature of 25C. Semi-dominant Unc.
EU716 zen-4(or153) IV. C. elegans Temperature-sensitive, embryonic-lethal mutant that lacks a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). About 100% of embryos produced by homozygous mothers hatch at 15C; 0% hatch at 26C. ZEN-4 = vertebrate MKLP1 kinesin. There are two mis-sense mutations present in zen-4(or153). One is a D520N (GAC to AAC) and the other is D735N (GAT to AAT). Whether one or both is responsible for the phenotype is not know. Maintain at 15C. Shift L4s to 26 overnight to observe mutant phenotype on embyros produced by adults.
EU718 div-2(or182) III. C. elegans Temperature sensitive. Maintain at 15C. CGC received new stock 2/2002.
EU769 spn-4(or25) unc-42(e270) V/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and lay 10/16 dead eggs. spn-4 unc-42 homozygotes are Unc and lay dead embryos exhibiting defects in mitotic spindle orientation and cell fate patterning. spn-4(or25) homozygotes are non-conditional maternal effect embryonic lethal.
EU772 spn-4(or80) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.
EU779 mex-1(or286) II. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU780 spd-2(or293) I; him-8(e1489) IV. C. elegans Him. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU782 zyg-1(or297) II. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU822 par-2(or373) III; lin-2(e1309) X. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU828 dhc-1(or195) I. C. elegans Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
EU833 div-2(or234) III. C. elegans Temperature sensitive. Maintain at 15C.
EU84 unc-5(e53) skn-1(zu67) IV/nT1 [let-?(m435)] (IV;V). C. elegans Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.
EU855 mom-2(or309) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Uncs, WT which give only dead eggs, and dead eggs. or309 is a deletion allele: removes exon 4 to 3' end and leave about 100 N-terminal amino acids.
EU856 spd-5(or213) I. C. elegans Homozygous or213 hermaphrodites make 100% dead embryos at 26C. No mitotic spindle assembly. Maintain at 15C.
EU858 tbb-2(or362) III. C. elegans Conditional, semi-dominant, maternal-effect, embryonic-lethal mutation. Once-cell stage mitotic embryos have short astral microtubules and a mispositioned mitotic spindle. Maintain at 15C.
EU863 div-(or361) him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU867 div-(or389) II. C. elegans Temperature sensitive. Maintain at 15C.
EU868 div-(or361) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU869 div-(or389) II; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU871 div-(or235) III; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU872 div-(or366) I; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU873 div-(or310) I. C. elegans Temperature sensitive. Maintain at 15C.
EU878 div-(or335) I; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU879 div-1(or345) III; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU880 div-1(or345) III. C. elegans Temperature sensitive. Maintain at 15C.
EU882 div-(or310) I; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU883 div-(or364) III; him-8(e1489) IV. C. elegans Temperature sensitive. Maintain at 15C.
EU888 div-(or366) I. C. elegans Temperature sensitive. Maintain at 15C.
EU91 apx-1(or3) V/nT1 [unc-?(n754) let-?] (IV;V). C. elegans Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.
EU918 lon-1(e185) par-3(it71)/qC1 [dpy-19(e1259) glp-1(q339)] III; spn-4(or191) V. C. elegans Temperature sensitive spn-1. Maintain at 15C. Lethal at 25C. Heterozygotes are WT and segregate WT, Lon which give only dead eggs at all temperatures, and Sterile Dpys(ts).
EU920 lit-1(or393) III; him-8(e1489) IV. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU923 spn-4(or191) V. C. elegans Temperature sensitive. Viable at 15C; lethal at 25C. At 25C, embryos exhibit defects in spindle orientation and cell fate patterning.
EU924 zyg-8(or484) III; lin-2(e1309) X. C. elegans Temperature-sensitive. Maintain at 15C. Reference: Gonczy P, et al. Dev Cell. 2001 Sep;1(3):363-75.
EU927 dpy-5(e61) mom-4(or49)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans Heterozygotes are WT and segregate WT, Dpys which give only dead eggs and dead eggs.
EU931 zyg-8(or490) III; lin-2(e1309) X. C. elegans Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C. Viable embryos at permissive temperature of 15C. Mitotic spindle in one-cell stage embryo assembles normally, but microtubules destabilize at anaphase and spindle becomes mis-positioned toward the posterior pole leading to highly abnormal cleavage and chromosome segregation defects. References: Gonczy P, et al. Dev Cell. 2001 Sep;1(3):363-75. Bellanger JM, et al. J Cell Sci. 2007 Aug 15;120(Pt 16):2963-73.
EU948 par-2(or539) III. C. elegans Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
GE2238 cyk-1(t1611) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs. Throws males.
GE2722 cyk-1(t1568) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. C. elegans Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs. Throws males.
JJ185 dpy-13(e184) skn-1(zu67) IV; mDp1 (IV;f). C. elegans Animals with the duplication are WT. Animals which have lost the duplication are Dpy and give only dead eggs.
OD1663 ltSi597 I; unc-119(ed3) III. C elegans ltSi597 [knl-1p::knl-1::mCherry::knl-1 3'UTR Cbr-unc-119(+)] I. mCherry labeled KNL-1. Reference: Hattersley et al., Dev Cell 2016 Sep 12;38(5):463-77. doi: 10.1016/j.devcel.2016.08.006. PMID: 27623381
OD334 ltSi1 II; unc-119(ed3) III. C elegans ltSi1 [knl-1p::knl-1(re-encoded)::RFP + Cbr-unc-119(+)] II. KNL-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Espeut J, et al. Cell Rep. 2015 Jul 7;12(1):58-65. doi: 10.1016/j.celrep.2015.05.039. PMID: 26119738
OD3392 knl-1(lt75[knl-1::mCherry]) III. C elegans mCherry tag inserted at N-terminus of endogenous knl-1 locus using by CRISPR/Cas9 engineering. Reference: Cheerambathur DK, et al. Dev Cell. 2019 Mar 25;48(6):864-872.e7. doi: 10.1016/j.devcel.2019.02.002. PMID: 30827898
OD416 ItSi98 II; unc-119(ed3) III; ItIs37 IV. C elegans ItSi98 [cpar-1p::GFP::cpar-1::cpar-1 3'UTR + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. mCherry-labeled histones. Reference: Gassmann R, et al. Nature. 2012 Apr 8; 484(7395): 534–537. doi: 10.1038/nature10973. PMID: 22495302.
OD987 ltSi264 II; unc-119(ed3) III. C elegans ltSi264 [bub-1p::bub-1(re-encoded)::RFP + Cbr-unc-119(+)] II. BUB-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Pelisch F, et al. Mol Cell. 2017 Jan 5;65(1):66-77. doi: 10.1016/j.molcel.2016.11.001. PMID: 27939944

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
or180 Allele substitution
or402 Allele substitution
or404 Allele substitution
or543 Allele
or358 Allele
or550 Allele substitution
or295 Allele substitution
or574 Allele
or346 Allele
or594 Allele
or593 Allele substitution
or676 Allele substitution
or621 Allele substitution
or598 Allele substitution
or640 Allele
or655 Allele deletion
or628 Allele substitution
or12 Allele
or749 Allele substitution
or77 Allele
or13 Allele
or683 Allele
or204 Allele substitution
or15 Allele
or20 Allele deletion
or633 Allele substitution splice_site
or634 Allele substitution
or28 Allele substitution
or600 Allele substitution
or577 Allele substitution
or22 Allele
or493 Allele substitution
or1018 Allele substitution
or409 Allele substitution
or454 Allele substitution splice_site
or430 substitution
or46 Allele
or10 Allele
or57 Allele
or81 Allele substitution nonsense
or85 Allele
or42 Allele
or25 Allele substitution
or36 Allele
or78 Allele deletion
or39 Allele
or19 Allele
or33 Allele
or11 Allele
or148 Allele substitution
or178 Allele
or153 Allele substitution
or183 Allele substitution
or191 Allele substitution
or184 Allele
or131 Allele substitution
or253 Allele
or198 Allele substitution
or207 Allele substitution
or209 Allele substitution splice_site
or278 Allele substitution
or182 Allele
or80 Allele
or286 Allele substitution nonsense
or293 Allele substitution
or297 Allele substitution
or373 Allele substitution
or195 Allele substitution
or234 Allele
or309 Allele deletion
or213 Allele substitution
or362 Allele substitution
or361 Allele
or389 Allele
or235 Allele
or366 Allele
or310 Allele
or335 Allele
or345 Allele
or364 Allele
or3 Allele
or393 Allele substitution
or484 Allele substitution
or49 Allele
or490 Allele substitution
or455 Allele substitution
or539 Allele
or552 Allele substitution nonsense
or302 Allele deletion
or344 Allele
or319 Allele
or374 Allele
or385 Allele
or570 Allele substitution
or301 Allele