| DLW109 |
C. elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID*]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW110 |
C. elegans |
wrdSi23 I; unc-18(knu969[unc-18::AID*]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW112 |
C. elegans |
reSi7 I; unc-104(knu973[unc-104::AID*]) II. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DLW114 |
C. elegans |
reSi7 I; unc-18(knu969[unc-18::AID*]) X. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID* into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DV3805 |
C. elegans |
reSi7 I. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| ESC794 |
C. elegans |
wrdSi23 cse772 [AID*::GFP::rpoa-2] I; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N terminus of endogenous rpoa-2 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| ESC796 |
C. elegans |
wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| ESC797 |
C. elegans |
wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| ESC818 |
C. elegans |
wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; set-2(ok952) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues in a set-2 mutant background. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| ESC825 |
C.elegans |
wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; ieSi11 II; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| ESC829 |
C.elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID*]) rpoa-1(cse829[rpoa-1::AID*::GFP]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at the C-terminus of the endogenous rpoa-1 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-1 and UNC-104 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| JDW225 |
C. elegans |
wrdSi23 I. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| RJP5296 |
C. elegans |
reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| SUR54 |
C. elegans |
wrdSi23 I; rubSi6 II; rubSi8[*rubSi7] IV; ltIs44 V. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). rubSi6 [eft-3p::scFv(glo)::GFP(smu-1 introns)::tbb-2 3UTR] II. rubSi8 [eft-3p::24xGCN4::AID::T2A::tagBFP::H2B::tbb-2 3UTR *rubSi7]) IV. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. SunTag system allows visualization of translation throughout development in real-time. In the absence of translation, GFP signal can be observed in the cytoplasm, nuclei and at epithelial apical membranes. At translation sites of the SunTag reporter, bright clustering of the GFP signal can be observed. Mature GCN4 proteins can be observed as dimmer GFP clusters in the absence of auxin, but not in the presence of auxin. Bright BFP signal from mTagBFP2::AID*::NLS and TagBFP::H2B can be visible in nuclei in the absence of auxin, in the presence of auxin only dimmer TagBFP::H2B is visible in nuclei. mCherry::PH marks the cell membranes throughout development. rubSi6 was inserted into ttTi5605 and also includes a partial duplication of the transgene (a portion of GFP with smu-1 introns and tbb-2 3UTR) downstream of the tbb-2 3UTR in the intact transgene. rubSi8 derived by modification of insertion of an AID tag into rubSi7, which is located in cxTi10816. Reference: van der Salm E, et al. Development. 2025 May 15;152(10):dev204435. doi: 10.1242/dev.204435. PMID: 40260543.
|
|