| VT3869 |
C. elegans |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
| HZ194 |
C. elegans |
apr-1(bp298) I; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. apr-1(bp298) is a G338E missense mutation disrupts the normal asymmetric division pattern of seam cells, causing symmetric divisions. Reference: Huang XX, et al. Dev Biol. 2009 Sep 15;333(2):337-47.
|
|
| HZ470 |
C. elegans |
sea-2(bp283) II; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells.
|
|
| HZ620 |
C. elegans |
ceh-16(bp323) III; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Temperature-sensitive: maintain at 20C or lower. bp323 mutants show reduced number of seam cells when raised at restrictive temperature (25C). Reference: Huang XX, et al. Dev Biol. 2009 Sep 15;333(2):337-47.
|
|
| JR667 |
C. elegans |
unc-119(e2498::Tc1) III; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Superficially wild-type.
|
|
| VT3500 |
C. elegans |
wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
|
|
| MAH132 |
C. elegans |
rrf-1(pk1417) I; unc-119(e2498::Tc1) III; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
|
|
| HS2372 |
C. elegans |
mig-1(e1787) I; cfz-2(ok1201) wIs51 V; lin-18(e620) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Bivulva. Presence of cfz-2 was confirmed by PCR. mig-1 and lin-18 were confirmed by sequencing. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| MH4810 |
C. elegans |
elt-1(ku491) IV; wIs51 V; daf-12(rh61rh411) X; kuEx194. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. kuEx194 [elt-1(+) + sur-5p::DsRed]. GFP expression in seam cells. Pick DsRed+ animals to maintain. In a daf-12(WT) background, elt-1(ku491) exhibits some precocious fusion of seamcells and gaps in alae. elt-1(ku491); daf-12(rh61rh411) double mutants have more sever heterochronic phenotypes including seamcell proliferation and bursting vulvae. Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.
|
|
| HS2067 |
C. elegans |
mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) wIs51 V; lin-18(e620) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Heterozygotes are GFP+(pharynx) wild-type and segregate GFP+(pharynx) wild-type, GFP-(pharynx) Sys Psa Unc and dead eggs. PIck GFP+(pharynx) wild-type to maintain. Presence of cfz-2 was confirmed by PCR; mig-1 by complementation test. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| MBA227 |
C. elegans |
wIs51 V; icbSi2. Show Description
wIs51 [SCMp::GFP + unc-119(+)]. icbSi2 [dpy-7p::mCherry::H2B::unc-54 + Cbr-unc-119(+)]. Seam cell nuclei labelled with GFP. hyp7 nuclei labelled with mCherry. Reference: Hintze M, et al. Genetics. 2020 Apr;214(4):927-939. doi: 10.1534/genetics.119.302896. PMID: 31988193.
|
|