Search Strains

More Fields
Strain Species Genotype Add
PD2856 C. elegans unc-54(cc2856[unc-54::gfp]) I. Show Description
Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23.
PD2859 C. elegans unc-54(cc2859[unc-54::GFP::TAA::NSUTR]) I. Show Description
Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1.
PD2882 C. elegans unc-54(cc2882[unc-54[G387R]::gfp::TAA::NSUTR]) I. Show Description
cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.
PD4092 C. elegans unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I. Show Description
Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.
RW12229 C. elegans unc-54(st12229[unc-54::TY1::EGFP::3xFLAG]) I. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
AM140 C. elegans rmIs132 I. Show Description
rmIs132 [unc-54p::Q35::YFP]. AM140 animals show a Q35::YFP progressive transition from soluble to aggregated as they age.
BC347 C. elegans unc-54(s74) I. Show Description
Paralyzed Rigid Unc. Muscle birefrigence normal. Muscle normal in EM.
CB1008 C. elegans unc-54(e1008) I. Show Description
Unc. Suppressed by sup-5 and sup-7.
CB1009 C. elegans unc-54(e1009) I. Show Description
Paralyzed Unc. Null allele.
CB1092 C. elegans unc-54(e1092) I. Show Description
Paralyzed Unc. Null allele.
CB1108 C. elegans unc-54(e1108) I. Show Description
Slow moving Unc.
CB1157 C. elegans unc-54(e1157) I. Show Description
Temperature sensitive. Unc. Recessive. Dominant Slow.
CB1168 C. elegans unc-54(e1168) I. Show Description
Paralyzed Unc. Null allele.
CB1201 C. elegans unc-54(e1201) I. Show Description
Paralyzed Unc. Null allele.
CB1258 C. elegans unc-54(e1258) I. Show Description
Paralyzed Unc. Null allele.
CB1300 C. elegans unc-54(e1300) I. Show Description
Unc. Suppressed by sup-5 and sup-7. Null allele? Milder than most null.
CB1301 C. elegans unc-54(e1301) I. Show Description
Temperature sensitive Unc.
CB1315 C. elegans unc-54(e1315) I. Show Description
Paralyzed Unc. Severe phenotype. Recessive. Null allele.
CB1419 C. elegans unc-54(e1419) I. Show Description
Unc. Suppressed by sup-5 and sup-7.
CB190 C. elegans unc-54(e190) I. Show Description
Semi-paralyzed Unc. Null allele. Recessive. M-MATING-NO SUCCESS.
CB569 C. elegans unc-54(e569) I. Show Description
Paralyzed Unc.
CB576 C. elegans unc-54(e576) I. Show Description
Slow movement.
CB651 C. elegans unc-54(e651) I. Show Description
CB675 C. elegans unc-54(e675) I. Show Description
Slow moving Unc. Semi-dominant.
CB843 C. elegans unc-54(e843) I. Show Description
Stiff. Body muscle abnormal.
CL2006 C. elegans dvIs2. Show Description
dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.
DR31 C. elegans unc-54(m31) I. Show Description
Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate.
DR32 C. elegans unc-54(m32) I. Show Description
Severe Unc. Growth slow. Recessive.
DR33 C. elegans unc-54(m33) I. Show Description
Movement very slow. Recessive.
DR34 C. elegans unc-54(m34) I. Show Description
Moves relatively well. Recessive.
DR36 C. elegans unc-54(m36) I. Show Description
Severe homozygous Unc. Heterozygotes are slow moving. Weakly semi-dominant. Body muscle abnormal.
DR37 C. elegans unc-54(m37) I. Show Description
Healthy. Recessive. Dauer recovery slow. Eggs laid rarely.
RW130 C. elegans unc-54(st130) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.
RW132 C. elegans unc-54(st132) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427. [Jan 2007: Taylor Allen suggests that st132 may have a temperature sensitive phenotype.]
RW134 C. elegans unc-54(st134) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.
RW135 C. elegans unc-54(st135) I. Show Description
Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.
RW5008 C. elegans unc-54(s95) I. Show Description
Paralyzed Rigid Unc. Muscle birefrigence is normal. Muscle is normal in EM.
RW5019 C. elegans unc-54(s291) I. Show Description
Unc.
CB2204 C. elegans unc-54(e190) I; eDp22 V. Show Description
Movement slow. Unc partially suppressed.
CB3035 C. elegans unc-54(e1258) I; wdDp1 V. Show Description
Suppressed Unc.
CL2122 C. elegans dvIs15. Show Description
dvIs15 [(pPD30.38) unc-54(vector) + (pCL26) mtl-2::GFP]. Control strain for CL2120. Phenotype apparently WT.
DR120 C. elegans unc-54(e1258) I; eDp23 V. Show Description
DR176 C. elegans unc-54(e190) I; eDp23 V. Show Description
Suppressed-movement slow. Unlinked double.
DR177 C. elegans unc-54(e1258) I; eDp22 V. Show Description
Suppressed-movement slow.
DR291 C. elegans unc-54(e675) I; eDp23 V. Show Description
Not suppressed. Unc-slow moving.
PD126 C. elegans unc-54(e190) I; ccIs126. Show Description
ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals.
PJ1037 C. elegans unc-54(e190) I; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V.
RG3098 C. elegans F20A1.10(ve598[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtatatatgtgcatttcgagcaacaaca ; Right flanking sequence: cggtttttatacatccaaattgagatcggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3221 C. elegans veDf2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. Show Description
Homozygous viable. 2996 bp deletion removes his-31, his-32, his-33 and his-34, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAGCATAGACGACGTCCATAGCAGTTA ; Right flanking sequence: CCTAATTGAGTTGTTCCAATAAAATTTTCA. sgRNA #1: CGAGCACGCCAAGAGAAAGA; sgRNA #2: TCTTTCAGAACAACATCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3887 C. elegans gkDf75[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] X. Show Description
Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGTTGCAGAAGTTGAACTCACTGTAACCA. Right flanking sequence: TGGACTGATGAGTAGAATGACAGGCGGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.