More Fields
Strain Species Genotype
DR32 C. elegans unc-54(m32) I. Show Description
Severe Unc. Growth slow. Recessive.
MQ465 C. elegans mum-1(qm32) IV. Show Description
Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 32% of embyros die. 80% of larvae die. 100% of adult survivors show a mutant phenotype.
DR1056 C. elegans unc-42(e270) ama-2(m323) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. (Chromosome carrying unc-42 ama-2 is homozygous lethal.) Strain is resistant to _-amanitin.
DR697 C. elegans cha-1(m324) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Lethals.
DR786 C. elegans ama-1(m322) IV. Show Description
WT strain. Resistant to _-amanitin.
DR806 C. elegans dpy-13(e184) ama-1(m118m328)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, DpyLet and dead eggs. Lethal early larval (L1) at 20C and 25C. Maintain by picking WT.
HBR232 C. elegans aptf-1(tm3287) II. Show Description
Complete lack of behavioral quiescence during sleep. Reference: Turek et al. Current Biology, 2013, 23, 2215-2223.
IM324 C. elegans nid-1(ur41) V; edIs20 X. Show Description
edIs20 [F25B3.3::GFP + rol-6(su1006)]. Rollers. Pan-neuronal GFP expression. ur41 has longitudinal nerve defects.
KMW1 C. elegans rha-1(tm329) II. Show Description
Strain grows normally at 16C. Egg laying is slightly delayed at 20C. Hermaphrodites and males have a maternal effect, temperature-sensitive sterile phenotype at 25.5C. Therefore, L4s shifted to 25.5C will lay offspring, but the offspring will be 90-100% sterile.
NG324 C. elegans wsp-1(gm324) IV. Show Description
Low penetrance (about 25%) embryonic lethality and reduced brood size. wsp-1(gm324) is an N-terminal deletion that exhibits no observable mRNA or protein.
QC128 C. elegans paqr-1(tm3262) IV. Show Description
Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC154 C. elegans paqr-2(tm3410) III; paqr-1(tm3262) IV. Show Description
This double mutant strain has a severely deformed tail tip and is intolerant of cold (will not grow then die at 15°C) and of dietary saturated fatty acids. Its cell membranes are rigid and rich in saturated fatty acids, and the strain has a small brood size, slow locomotion, permeable cells, autophagy defects as well as other phenotypes. References: Svensson E, et al. PLoS ONE 6(6):e21343. PMID: 21712952. Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
RM3218 C. elegans pha-1(e2123) III; cho-1(tm373) IV; mdEx790. Show Description
mdEx790 [cho-1p(7.6kb)::cho-1::GFP + pha-1(+) + pBluescript]. CHO-1 translational fusion driven by 7.6 kb cho-1 promoter rescues cho-1 mutant behaviors, including reduced initial thrashing rate, fatigue, and synthetic interactions with pmt-2. Strong fluorescence in nerve ring, and ventral and dorsal nerve cords. Structure of the transgene is shown in Figure 1 of Mullen et al., 2007.
RM3248 C. elegans oct-1(gk354) I; cho-1(tm373) IV; chtl-1(ok1695) X. Show Description
Approximately wild-type in appearance, growth, and movement. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
RM3286 C. elegans snt-1(md290) II; unc-41(e268) V. Show Description
Unc.
VC1228 C. elegans klp-11(tm324) IV. Show Description
331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ZB2844 C. elegans hpa-1(tm3256) IV. Show Description
Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.