More Fields
Strain Species Genotype
CB1009 C. elegans unc-54(e1009) I. Show Description
Paralyzed Unc. Null allele.
CA1216 C. elegans air-2(ie31[degron::GFP::air-2]) I. Show Description
Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923
CA1217 C.elegans air-2(ie31[degron::gfp::air-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering allows auxin-inducible degradation (AID) of AIR-2 in germ line and early embryos. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923
TQ10515 C. elegans seld-1(xu408) IV. Show Description
seld-1(xu408) is a G314E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10516 C. elegans scbp-2(xu418) I. Show Description
scbp-2(xu418) is a G47R missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10517 C. elegans gspd-1(xu416) IV. Show Description
gspd-1(xu416) is a E375K missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10518 C. elegans gspd-1(xu409) IV. Show Description
gspd-1(xu409) is a L399F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10519 C. elegans gsr-1(xu413) III. Show Description
gsr-1(xu413) is a S21F missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10520 C. elegans seld-1(xu415) IV. Show Description
seld-1(xu415) is a G170E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10521 C. elegans gsr-1(xu414) III. Show Description
gsr-1(xu414) is a G279E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10548 C. elegans trxr-1(xu421) IV. Show Description
trxr-1(xu421) is a W275* nonsense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ8245 C.elegans lite-1(xu492) X. Show Description
Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.
WRM45 C. elegans mex-3(spr5[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 488 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM49 C. elegans mex-3(spr6[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr6) is a CRISPR/Cas9 engineered deletion removing 142 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM50 C. elegans mex-3(spr7[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr7) is a CRISPR/Cas9 engineered deletion removing 134 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM52 C. elegans mex-3(spr9[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp). Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM53 C. elegans mex-3(spr10[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 190 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
ZH2486 C. elegans enIs74 II; unc-76(e911) V. Show Description
enIs74 [mec-7p::GFP + dyn-1p::mfg-e8::mCherry + unc-76(+)] II. mec-7p::GFP labels touch neurons. MFG-E8::mCherry reporter binds exposed phosphatidylserine (PS) “eat me” signal on the surface of apoptotic or necrotic cells, providing a useful marker for identifying apoptotic or necrotic cells. Reference: Furuta Y, et al. PLoS Genet. 2021 Feb 11;17(2):e1009066.