Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
IG10 C. elegans tol-1(nr2033) I. Show Description
Healthy and fertile but exhibit a lowly penetrant lethality, and a small but significant proportion of the mutants arrest as early larvae. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.
IG130 C. elegans tol-1(nr2013) I. Show Description
Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.
ENL69 C. elegans tol-1(nr2033) I; sma-10(ok2224) IV. Show Description
Derived from RB1739 and IG10.
KRA867 C. elegans tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I; lat-1(syb8408[lat-1(before 651 aa)aaaaA::EGFP::linker::3xFLAG::aaaaA]) II. Show Description
syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX6073 C. elegans tol-1(syb6073[Q712A,Y713A,G714A,N715A]) I. Show Description
Reduced brood size; high rates of embryonic and larval arrest. CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX8406 C. elegans tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I. Show Description
WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX8810 C. elegans tol-1(syb8810[tol-1 Q712A,Y713A,G714A,N715A] *syb8406) I. Show Description
CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reduced brood size, high levels of embryonic and larval arrest. syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
RG3530 C. elegans tol-1(ve1030[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 17737bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested malformed larvae (ve1030 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ACCCAACTGACCATTCACCCGTCTCCTCCT; Right flanking sequence: CGGACAGATTCTACGGAAGCACACGAGAAT. tol-1 crRNA A: GGTGGTTGTTGTAGAGGGGG; tol-1 crRNA B: AATCTGCTGGACGATGAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.