Search Strains

More Fields
Strain Species Genotype Add
BC157 C. elegans dpy-14(e188) unc-13(e51) let-80(s96)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and Lethal DpyUncs. Lethal early larval. Pick WT to maintain.
BC4874 C. elegans dpy-17(e164) let-809(s2844) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
ML2501 C. elegans let-805(mc73[let-805::gfp + unc-119(+)]) unc-119(ed3) III. Show Description
Superficially wild-type. mc73 was generated by using Crispr/Cas9 to add a GFP tag to the endogenous let-805 locus and also insert a rescuing unc-119 transgene. Reference: Quentin S, et al. Development 2016 143: 160-173; doi: 10.1242/dev.126615.
RG3478 C. elegans let-805(ve978[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Emb. Deletion of 22058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), dead embryos (ve978 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aggtagaaaaaatgtagactagccccccct; Right flanking sequence: tcgttttccaaattaatcagaaattagcat. let-805 sgRNA #1: tgagtcagcagaggccgggg; let-805 sgRNA B: attacGTTGGGTTGCAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW3625 C. elegans let-805(st456)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segreate WT, Dpy Steriles, and lethals: arrested elongation at 2 fold; body wall muscle cells detach at embryonic stage when the muscle cells begin to contract - therefore, little embryonic movement is observed.