Search Strains

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.

Weak left-handed roller as adult.

Unc. Weak coiler.

DpyUnc.

Unc. Eat mutant. Slippery pharynx-Slight relaxation defect.

Heterozygotes are WT and segregate WT, Vuls (bags) and DpyUncs. n2030: Vul; impenetrant Mel (rod-like larval-lethal).

atrIs1 [ftt-2p::ftt-2::mCherry + unc-119(+)]. Line is slightly sick and burrows. FTT-2::mCherry fusion protein rescues ftt-2(tm1486) deletion mutant. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. PMID: 28648843

Multi-vulva (Muv).

Very slow growth.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 589 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1020 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGACAACTTAATCTTGAGTGAAATCTTCCT; Right flanking sequence: TACTTCATTTTCTTGCAAAACGATTTCCCA. F32D8.5 crRNA A: ATTAAAAGCAGGTTCAGCGC; F32D8.5 crRNA B: GTAGCGGAGTGAAAGATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1579 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGGAATGCCTCGGCTATTTTTCAGTTTTT ; Right flanking sequence: Ctttatttttaagtttttttaatctccctt. F55C10.5 crRNA A: CGGTAAAATTCAGTCTGTCT; F55C10.5 crRNA B: TTTATTATGTGCACACTCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4718 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCTATCAACTCGTTACGATAAGAATGACCA ; Right flanking sequence: CTCTATAGTCTCTCGATCTATTGACATTAG. C35C5.10 crRNA A: CTTTTCCCCCTCCCGACAAG; C35C5.10 crRNA B: TTGACGTTGTGACAAAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3334 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATCTTGTAAAGTTTTTCGTGTTCTTCCA ; Right flanking sequence: TGGAAAAATCAGACtttagttttttttAAT. F21D5.4 & F21D5.5 crRNA A: TTTCCGCCCGAAATTCGAAG; F21D5.4 & F21D5.5 crRNA B: TCATCAAATCGCCGTTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atcaaatcgtaatgggacagcatggcacca ; Right flanking sequence: AGGTACGATTTTGTGTTAATTCCTTGGAAA. faah-5 crRNA A: ATTTCCTCTTATAACCcacg; faah-5 crRNA B: TTATTCGAGTGGGCAATTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2359 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGGTTCTCAGAATGGGAAAGATCATGCCG ; Right flanking sequence: GGGATTGAACTTTTACAATTTTAACTTTCA. K07C5.3 crRNA A: TTTGCAGCCACGAAGAAGTT; K07C5.3 crRNA B: ATGCTCTGAGAAGTTATGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2023 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACGGTCGAAAAGCTTCAATCCCTCACCT ; Right flanking sequence: GGTGGATTTGTCTAACCGAAAATTCACAAC. glct-2 crRNA A: GGTTTCAGAACACTCATCGT; glct-2 crRNA B: ATTCTGATTGTCCATTcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 8422 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTCTCCTGACTGGGCATATTGAACTTAACA ; Right flanking sequence: CGGCTGAATTTGGTGTGGTCGCTGCACATT. pqn-15 crRNA A: TTCAACTTGAGTTTGATCGG; pqn-15 crRNA B: ATGACCCGATGTGGACCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1827 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTCAACTTTAACCAACTTTGACTTCTCT ; Right flanking sequence: ACAACTGTTTCACGGTGCAATTTcacaggg. cpr-2 crRNA A: GGATGGCAGTTAGAACGTGG; cpr-2 crRNA B: ATATTTGGCACGACCTCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Higher axon regeneration in aged animals. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73.

oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Neuron. 2012 Jan 26;73(2):268-78.