Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB1005 C. elegans unc-59(e1005) I. Show Description
Poor backward movement. Protrusive vulva. Gonad extrusion. Egg-laying defects. Recessive.
RG3505 C. elegans tsr-1(ve1005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
AML32 C. elegans wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517.
CV203 C. elegans rjSi1 II. Show Description
rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029
CV385 C. elegans acer-1(rj15) II. Show Description
acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion. Increased histone acetylation. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.
JIM113 C. elegans ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. Reference: Zacharias A, et al. PLoS Genet. 2015 Oct 21;11(10):e1005585.
JIM173 C. elegans unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
MH4799 C. elegans elt-1(ku491) IV. Show Description
Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.
MH4810 C. elegans elt-1(ku491) IV; wIs51 V; daf-12(rh61rh411) X; kuEx194. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. kuEx194 [elt-1(+) + sur-5p::DsRed]. GFP expression in seam cells. Pick DsRed+ animals to maintain. In a daf-12(WT) background, elt-1(ku491) exhibits some precocious fusion of seamcells and gaps in alae. elt-1(ku491); daf-12(rh61rh411) double mutants have more sever heterochronic phenotypes including seamcell proliferation and bursting vulvae. Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.
NK1531 C. elegans unc-119(ed4) III; qyIs366 V. Show Description
qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.
NK1532 C. elegans qyIs368 I; unc-119(ed4) III. Show Description
qyIs368 [ser-2(prom3)::dma-1::GFP + unc-119(+)] I. Reporter allows visualization of DMA-1 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.
PX356 C. remanei ssp. vulgaris C. remanei ssp. vulgaris wild isolate. Show Description
Male-female strain. Low fecundity and fitness. PX356 is an inbred strain derived from EM464. Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.
PX439 C. remanei Caenorhabditis remanei wild isolate. Show Description
Male-female strain. Low fecundity and fitness. PX439 is an inbred derivative of isofemale line PB259 originally collected from a forest in Ohio (USA) by Scott Baird (Wright State University). Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.
QC136 C. elegans iglr-2(et34) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC137 C. elegans iglr-2(et37) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC138 C. elegans iglr-2(et38) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC139 C. elegans paqr-2(et35) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC140 C. elegans paqr-2(et36) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.