| NL1000 |
C. elegans |
cdh-3(pk87) III. Show Description
2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.
|
|
| NL721 |
C. elegans |
cdh-3(pk77) III. Show Description
ZK112.7. Insertion sequence: TGGAGATACG TA GGTTTTTGAT.
|
|
| PS3352 |
C. elegans |
syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Line is a slightly Dpy, but appears healthy. Reference: Pettitt J, et al. Development. 1996 Dec;122(12):4149-57. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS3517 |
C. elegans |
unc-119(ed4) III; syIs57 X. Show Description
syIs57 [cdh-3::CFP + unc-119(+)]. Unsure if unc-119(ed4) remains in the background. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS3528 |
C. elegans |
syIs51 V; syIs55 X. Show Description
syIs51 [cdh-3::CFP + unc-119(+)] is expressed in vulC, vulD, vulE and vulF. syIs55 [ceh-2::YFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC.
|
|
| YG1007 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express cdh-3::GFP at the anchor cell. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| GS3754 |
C. elegans |
sel-13(ok303) III; arIs51 IV; sel-7(n1253) unc-3(e151) X. Show Description
arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC.
|
|
| OH16446 |
C. elegans |
cdh-3(ot1035) III. Show Description
CRISPR/Cas9 engineered deletion of full cdh-3 locus.
|
|
| OH17000 |
C. elegans |
cdh-3(ot1096[cdh-3::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-3 locus.
|
|
| PS3475 |
C. elegans |
unc-119(ed4) III; syIs51 V. Show Description
syIs51[cdh-3::CFP + unc-119(+)] V. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS3476 |
C. elegans |
unc-119(ed4) III; syIs52 X. Show Description
syIs52[cdh-3::cfp + unc-119(+)] X. Expressed in vulC, vulD, vulE and vulF. Do not distribute this strain; other labs should request it from the CGC.
|
|
| DQM1152 |
C. elegans |
bmdSi243 I; ljf3(unc-34::mNG[C1]^3xFlag::AID*) V; qy41(lam-2::mKate2) X. Show Description
bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
|
|
| DQM1261 |
C. elegans |
bmdSi338 I; qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi338 [^SEC^lin-29p::FLP::p2A::H2B::2xmTurq2] I. qyIs225 [cdh-3p::mCherry::moeABD] V. Pick Rollers to maintain. Wild-type growth and movement. mNG tag inserted into endogenous lam-2 locus. Anchor cell-specific FLP for targeted protein degradation. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
|
|
| NK1339 |
C. elegans |
rrf-3(pk1426) II; qyIs127 V; qyIs166 X. Show Description
qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.
|
|
| NK2609 |
C.elegans |
qyIs50 V; qyIs550. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. Superficially wild-type animals expressing mitochondrial GFP and red F-actin in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2617 |
C. elegans |
qyIs23 II; IqIs80 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. Utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2629 |
C. elegans |
fdgt-1(tm3165) qyIs23 II; qyIs10 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. qyIs10 [lam-1p::lam-1::GFP + unc-119(+)] IV. fdgt-1 formerly known as fgt-1. Reference: Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2635 |
C. elegans |
fdgt-1(tm3165) II; qyIs50 V. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. fdgt-1(tm3165) null mutant expressing an anchor cell specific F-actin marker. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2639 |
C.elegans |
fdgt-1(tm3165) II; qyIs50 V; qyIs550. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. fdgt-1 glucose transporter null mutants (tm3165) expressing anchor cell specific mitochondrial matrix localized GFP and F-actin mCherry. Useful for analyzing mitochondrial localization, morphology and dynamics in the absence of glucose import. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2657 |
C. elegans |
nuo-1(qy143[nuo-1::mNG]) II; unc-119(ed4) III; qyIs50 V. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.
|
|
| NK2689 |
C. elegans |
lin-35(n745) I; qyIs23 II; IqIs80 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2721 |
C. elegans |
qySi569 I. Show Description
qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. Superficially wild type animal expressing a single copy insertion of glucose transporter fdgt-2 in the anchor cell. fdgt-2 formerly known as fgt-2. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2752 |
C. elegans |
qyIs555. Show Description
qyIs555 [cdh-3p::aman-2::GFP]. Anchor cell specific expression of golgi protein aman-2. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2785 |
C.elegans |
qySi569 I; fdgt-1(tm3165) II. Show Description
qySi569 [cdh-3p::fdgt-2::mNG + loxP] I. fdgt-1 glucose transporter null mutant expressing a single copy insertion of the glucose transporter fgt-2 in the anchor cell. fdgt-1 and fdgt-2 formerly known as fgt-1 and fgt-2, respectively. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK3030 |
C. elegans |
qySi229 I. Show Description
qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3066 |
C. elegans |
rrf-3(pk1426) II; qyIs221. Show Description
qyIs221 [cdh-3p::GFP::ced-10]. Maintain at 20C or lower. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK413 |
C. elegans |
rrf-3(pk1426) II; qyIs50 V. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V.
|
|
| TV28592 |
C. elegans |
bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
|
|
| TV28593 |
C. elegans |
bmdSi339 I; bmdSi297 II; arx-2(wy1815[arx-2::AID::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID* and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
|
|
