| CB1111 |
C. elegans |
cat-1(e1111) X. Show Description
Catecholamine abnormal. Recessive. M-MATING++ 1-10%WT. Previously called ctl-2.
|
|
| KP1287 |
C. elegans |
nuIs26 IV. Show Description
nuIs26 [cat-1::GFP] IV. nuIs26 contains a full length CAT-1::GFP fusion protein (with GFP fused at the predicted carboxy terminus of CAT-1). This transgene rescues the hyperactive locomotion defect of cat-1(e1111). This strain is slightly sluggish for locomotion and has a high degree of sterility (80%), both of which appear to be associated with the transgene. GFP expression in this strain is similar to the CAT expression pattern described by Duerr et al (1999) J Neurosci 19: 72-84.
|
|
| RB681 |
C. elegans |
cat-1(ok411) X. Show Description
W01C8.6. Homozygous. Outer Left Sequence: CCATTGAATGTGCAACGAAC. Outer Right Sequence: ATGGATTAGCAGTCCATCGC. Inner Left Sequence: TCGAGTGACCTCAAACATGC. Inner Right Sequence: ATGCAAGCATACTGGGAAGG. Inner primer WT PCR product: 2850. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RM1845 |
C. elegans |
cat-1(e1111) X. Show Description
Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes.
|
|
| DCR3791 |
C. elegans |
pfk-1.1(ola72) X. Show Description
Diffuse distribution of synaptic vesicle markers (SNB-1, CAT-1, and RAB-3) under hypoxic conditions. pfk-1.1(ola72) causes C562Y missense mutation. Reference: Jang et al. Neuron. 2016 Apr 20;90(2):278-91.
|
|
| OH10194 |
C. elegans |
ceh-43(tm480) otIs221 III; him-8(e1489) IV; norEx41. Show Description
otIs221 [cat-1::GFP]. norEx41 [ceh-43(fosmid) + dat-1::mCherry]. Him. tm480 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
|
|
| OH15039 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otIs625. Show Description
otIs625 [cat-1(fosmid)::SL2::mCherry::H2B + pha-1(+)]. Fosmid-based cat-1 reporter marks aminergic neurons.
|
|
| OH19781 |
C. briggsae |
Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19827 |
C. tropicalis |
Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH8249 |
C. elegans |
otIs224. Show Description
otIs224 [cat-1(2493bp)::GFP].
|
|
| OH8480 |
C. elegans |
otIs221 III; him-8(e1489) IV. Show Description
otIs221 [cat-1::GFP]. GFP expression in monoaminergic neurons. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
|
|
| OH9279 |
C. elegans |
otIs266. Show Description
otIs266 [cat-1p::mCherry]. A 2.5 kb upstream region of cat-1 ATG was cloned into pPD95.75 vector and GFP was replaced with mCherry. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
|
|
| OP218 |
C. elegans |
unc-119(ed3) III; wgIs218. Show Description
wgIs218 [R02D3.7::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. R02D3.7 also known as rcat-1. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OU6 |
C. elegans |
png-1(cy9) I; cyIs4. Show Description
cyIs4 [cat-1::GFP + rol-6(su1006)]. Reference: Habibi-Babadi N, et al. J Neurosci. 2010 Feb 3;30(5):1766-76.
|
|
| PHX6486 |
C. elegans |
cat-1(syb6486[cat-1::SL2::GFP::H2B]) X. Show Description
Endogenous cat-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| PHX8612 |
C. elegans |
bcat-1(syb8612[bcat-1::SL2::GFP::H2B]) X. Show Description
Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| RB1488 |
C. elegans |
rcat-1(ok1745) IV. Show Description
R02D3.7 Homozygous. Outer Left Sequence: acccgttttcaacaaaacca. Outer Right Sequence: cagtggaattgatgacgtgg. Inner Left Sequence: ttcagccatcagcatacagc. Inner Right Sequence: tgacttttccgccatttttc. Inner Primer PCR Length: 2461. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG3078 |
C. elegans |
+/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. Show Description
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RW11460 |
C. elegans |
unc-119(tm4063) III; stIs11460. Show Description
stIs11460 [R02D3.7::H1-wCherry + unc-119(+)]. R02D3.7 also known as rcat-1.
|
|
| TL8 |
C. elegans |
bam-2(cy6) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
| TL9 |
C. elegans |
bam-2(cy7) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
| VH7215 |
C. elegans |
mcat-1(hd7179[LoxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + LoxP])/ lin-42(tmIs1226) II. Show Description
Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with FX30266. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and tmIs1226 mCherry+ homozygotes. Derived from parental strains VH7179 and FX30266. hd7179 is a deletion of 1609 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGACATTGCACACCGGACGATGAATCTCCA; Right flanking sequence: TGGAATATCCATCACCTGTAGAAATAAAAA. sgRNA #1: GGCAAAAGCTTTCCAAAACG; sgRNA #2: TCGAAAACTCGCCGTGCCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| OH16765 |
C. elegans |
otIs794. Show Description
otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|