Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AL132 C. elegans icIs132. Show Description
icIs132 [unc-40::GFP]. Superficially wild-type. unc-40 translational reporter. Reference: Chan SS, et al. Cell. 1996 Oct 18;87(2):187-95.
BA825 C. elegans spe-26(hc140) dpy-20(e1282)/+ IV. Show Description
Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.
BA838 C. elegans spe-26(hc140) IV. Show Description
Temperature sensitive. Weak Dpy and partial fertility at 15C (very few progeny). Sterile at 20C and 25C. Spermatogenesis arrests at the spermatocyte stage.
BW1039 C. elegans dpy-5(e61) unc-40(e271) I. Show Description
DpyUnc. Slightly Egl.
BW1049 C. elegans unc-40(e271) bli-4(e937) I. Show Description
UncBli Strain. Blisters late.
CB2261 C. elegans dpy-5(e61) unc-40(e1430) I. Show Description
DpyUnc.
CB271 C. elegans unc-40(e271) I. Show Description
Unc. Small. Egg Retainer. Serotonin Def. Recessive. M-MATING-NO SUCCESS.
CGC140 C. elegans goa-1(n499)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
This strain is difficult and time consuming to maintain. Gives relatively few heterozygotes. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are paralyzed Unc and Egl with relatively dim pharyngeal GFP (Venus) expression. Heterozygotes segregate heterozygous non-Dpy GFP+ paralyzed Unc and Egl, non-GFP embryonic lethal (homozygous n499), and Dpy with brighter GFP+ (tmC20 homozygous). Remove Dpy from plate to prevent them from taking over. Heterozygotes tend to stack up in parallel clumps. Populations can be enriched by transferring these clumps to new plates and allowing Dpy (tmC20 homozygotes) to crawl out into bacterial lawn, and then picking away Dpy or transferring the clump of Hets to another plate. Derived by balancing n499 from parental strain MT1102 over tmC20 from FX30179.
CHS1183 C. elegans str-185(yum2093) str-188(yum2094) str-187(yum2095) str-190(yum2096) str-178(yum2097) y116a8c.40(yum2098) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1227 C. elegans srbc-40(yum2370) srbc-41(yum2371) srbc-43(yum2372) srbc-44(yum2373) srbc-45(yum2374) srbc-48(yum2375) srbc-49(yum2376) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
ESC440 C. elegans reSi2 II; tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of TSR-2 in epidermal tissues. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
KC440 C. remanei Show Description
Caenorhabditis remanei mutant. Dumpy. Slightly Uncoordinated. Male-female strain.
LE2336 C. elegans lqIs128. Show Description
lqIs128 [unc-25p::MYR::unc-40(constitutively active)::GFP + unc-25p::GFP]. Contains a myristylated, constitutively-active form of UNC-40. Slightly Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
LE2492 C. elegans lqIs151. Show Description
lqIs151 [scm::unc-40::GFP + str-1::GFP].
LE2531 C. elegans unc-40(n324) I; juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
MT1068 C. elegans unc-40(n473) I. Show Description
MT14678 C. elegans lgc-40(n4545) X. Show Description
1.029 kb deletion in T24D8.1 encoding ligand-gated chloride channel that is a low affinity serotonin receptor. Homozygous viable.
MT324 C. elegans unc-40(n324) I. Show Description
NK2672 C. elegans unc-40(qy68[unc-40::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous unc-40 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
PS8301 C. elegans oac-40(sy1258) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAAATTTCTTATGGGAAACTAATAACCGGTA Right flanking sequence: TTCGTTGGCTTCATTATTTTTAGTCACAAATCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAATGAAGCCAACGAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
QC140 C. elegans paqr-2(et36) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
VC140 C. elegans eif-3.K(gk126) V. Show Description
T16G1.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC240 C. elegans nex-1(gk148) III. Show Description
ZC155.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC340 C. elegans dao-5(ok542)/hT2 I; +/hT2 [bli-4(e937)] III. Show Description
C25A1.10. Heterozygotes are WT, and segregate WT, arrested hT2 aneuploid progeny, Bli hT2 homozygotes, and homozygous ok542 hermaphrodites (arrest stage/phenotype undetermined). The bli-4 mutation does not express until the adult, and is sometimes extremely subtle. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC440 C. elegans mif-3(gk228) I. Show Description
F13G3.9, F13G3.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC540 C. elegans rimb-1(ok761) III. Show Description
Y39A3CL.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC740 C. elegans F20D1(gk323) X. Show Description
F20D1. Superficially wild type; affects pseudogene. External left primer: GGTATGACCAGCAAGACCGT. External right primer: CGTACATTGATGCTCGGTTG. Internal left primer: TGGGACAAAGACCATTCACA. Internal right primer: TTGTTTGGGATGTTGGAGGT. Internal WT amplicon: 1634 bp. Deletion size: 806 bp. Deletion left flank: CTTTACAGTGAATTATATTGCTCATGAAAC. Deletion right flank: CTCTCTATTCTTGAGTGAACCCAAATCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC840 C. elegans rig-6(gk449) II. Show Description
C33F10.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC940 C. elegans let-99(ok1403) IV/nT1 [qIs51] (IV;V). Show Description
K08E7.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1403 homozygotes (Mel; adult lays eggs, some hatch into abnormal L1s that arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
XE3354 C. elegans unc-40(wp221) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. wp221 is a CRISPR-engineered deletion of unc-40 exon 14.5 near the splice sites of exons 14 and 15. mec-4p::GFP is expressed in touch neurons. Reference: Weinreb A, et al. Nat Commun. 2025 May 16;16:4508. doi: 10.1038/s41467-025-58293-5. PMID: 40379606.