sEx15828 [rCesF20D1.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

raEx298 [F20D1.10::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

F20D1.6 Homozygous. Outer Left Sequence: gcagcaaacacagcttggta. Outer Right Sequence: ttgcatcaagtggaccttca. Inner Left Sequence: gcagtgccaaaccttcattt. Inner Right Sequence: gtccgctgcttttgtttctc. Inner Primer PCR Length: 3087. Deletion ize: 1077 bp. Left flank: ATCAGTAAAAATTTATGTTCAGAATGATGT. Right flank: CATTCAGATTTTGATATCAACTATTCTTCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D1.6 Homozygous. Outer Left Sequence: gcagcaaacacagcttggta. Outer Right Sequence: ttgcatcaagtggaccttca. Inner Left Sequence: gcagtgccaaaccttcattt. Inner Right Sequence: gtccgctgcttttgtttctc. Inner Primer PCR Length: 3087. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D1.4. Homozygous. Outer Left Sequence: CATCTGCTTCTTGACCCACA. Outer Right Sequence: AATGTTTCGGAGAACAACGG. Inner Left Sequence: GAATCCGCTCAATATCCGAA. Inner Right Sequence: AACAAAAGAAGGGGGAAGGA. Inner Primer PCR Length: 2161 bp. Deletion Size: 1616 bp. Deletion left flank: TTTTGTTGTATAATTCCTCTTGATAATTAC. Deletion right flank: TTTTTAATTTACCGTGATTTTATTTCATAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D1.1 Homozygous. Outer Left Sequence: tgcacaactcggaaatgaaa. Outer Right Sequence: aatccaaagcttatcgcgtg. Inner Left Sequence: gcttaagtgagaggaggggg. Inner Right Sequence: gcaattctcaacggttttctc. Inner Primer PCR Length: 1207. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATATGCAGCAACTTAAGAtttttttttCA ; Right flanking sequence: TATCCAACTCAGAAGAAGAAGAAGAGCTGC. sgRNA #1: GATTTGGCGCATCAACTGCA; sgRNA #2: GTAGGCATTCTGTCCATCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F20D1. Superficially wild type; affects pseudogene. External left primer: GGTATGACCAGCAAGACCGT. External right primer: CGTACATTGATGCTCGGTTG. Internal left primer: TGGGACAAAGACCATTCACA. Internal right primer: TTGTTTGGGATGTTGGAGGT. Internal WT amplicon: 1634 bp. Deletion size: 806 bp. Deletion left flank: CTTTACAGTGAATTATATTGCTCATGAAAC. Deletion right flank: CTCTCTATTCTTGAGTGAACCCAAATCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D1 (deletion affects clone sequence not attached to any gene). Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

sEx10228 [rCes F20D12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10611 [rCes F20D12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10766 [rCes F20D12.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

F20D12.3 Homozygous. Outer Left Sequence: gaatcggatcaaggacctca. Outer Right Sequence: tatgtggatcaacgttgcca. Inner Left Sequence: tggatgataatgtcgaacttgc. Inner Right Sequence: tttacacatctcaaaaatcagtgaa. Inner Primer PCR Length: 1215. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTTCAAAAAGTCCCTCTGCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: TTATGTGAGGCTTCGACACG. Internal WT amplicon: 1741 bp. Deletion size: 712 bp. Deletion left flank: GATAATGTCGAACTTGCAAATGTATTTTCG. Deletion right flank: TTAAAAGAAAGACAATGGAGAATCAAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTCAACTGAGCAGCTTGTCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: CTGCAGCATCGTTAGCTTTG. Internal WT amplicon: 3305 bp. Deletion size: 2306 bp. Deletion left flank: AACGGATGAAATAACATGTTTGGCTCATGT. Deletion right flank: GTGAAAGAGATTATCATTCGTGCTGAAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4523 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCGCTCGCCAGCCGTCTCACGGTTCCTTCA. Right flanking sequence: CGATGATAATCTTTCCGATTTACTGTATTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F20D12.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807