Search Strains

K09A9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3301 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATTCAAATCAGGGTGGAGG. External right primer: TGCCACTGAAAAGCTCATTG. Internal left primer: GCGCGTGTGGTCCTAATTT. Internal right primer: AAAATCTTCAACTCGGTCCAA. Internal WT amplicon: 1268 bp. Deletion size: 560 bp. Deletion left flank: TGTAAATTTAAAATTTTTTATATATAATAT. Deletion right flank: GCTCATCGATACGTTCTGGGAACTTGATGG. Insertion Sequence: CGATAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22F1.2. External left primer: ACAGGGGATTATGGGAGGAC. External right primer: TTCGCCACTTGTTCAATCTG. Internal left primer: ACTGGGCCTTGAGAGAATCA. Internal right primer: ATTTACACTGTGCACACCCG. Internal WT amplicon: 1206 bp. Deletion size: 594 bp. Deletion left flank: TTAGTCATTTTGTGTCCATCGATATCTTCC. Deletion right flank: CGCGAACACCATTTATCTCTTTGTGAATCA. Insertion Sequence: TA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54G2.2. External left primer: AATCAGTTAAAGGGGTGGGG. External right primer: CAGCAACAAACTCAGCCAAA. Internal left primer: AATGGTGGGTGGTTGTCTGT. Internal right primer: TGTTCACACTTTAGATGTATTTCCG. Internal WT amplicon: 1153 bp. Deletion size: 625 bp. Deletion left flank: ACGAGATGGAAAGACCATCATCCTGCTTCT. Deletion right flank: CAGAGCTGAATTCCCATTTTTCCATATTCA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G1.6. External left primer: GGCAGTTTGTCTTTTCACCC. External right primer: CAGAAGACATCGACAGGCAA. Internal left primer: TCTTGTGCTTGATGAGAGGAA. Internal right primer: CGTTCCGAAGGAGATGATGT. Internal WT amplicon: 1326 bp. Deletion size: 484 bp. Deletion left flank: GAATCTTTCTGTTGGTGGATGAACTTCCAA. Deletion right flank: GCTGTATCTGGAGCAACTGTCGTCGTCGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C13B9.4. External left primer: CGTGGAATCATCGCTACCTT. External right primer: TTTATGCAGGCTTATTGCCC. Internal left primer: TTTACTCCTTGACGGGAACG. Internal right primer: TCAGGCGGCTTCGAGTATT. Internal WT amplicon: 1261 bp. Deletion size: 605 bp. Deletion left flank: ATCCCTAGTTGGTGCAAACGGAATTGTTTG. Deletion right flank: ATAGAGTACCAGCCGAAGTATTACAACCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F4.3. External left primer: TTGGTTTTCCAAAGTCCCAG. External right primer: GAATCACAAAAGAACCGCGT. Internal left primer: CTGCATGGATTGTGTTTTGAA. Internal right primer: TGCCCCATATCACATTACAGA. Internal WT amplicon: 1207 bp. Deletion size: 398 bp. Deletion left flank: CGGGGTCCACGCAGACGACGTCGACACACA. Deletion right flank: TTGATTAATTAATTAATTTTCAGATCACTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29F7.1. External left primer: CAAAGCTGGGTGAAGGTGTT. External right primer: CATAAGATTGGCATCTCGCA. Internal left primer: GATGTTAACAAAGGCAACGC. Internal right primer: AGGTTTTCCATCGGTCTGAA. Internal WT amplicon: 1264 bp. Deletion size: 309 bp. Deletion left flank: AAAAAGTTTTTTTAGAACTTTTTTATTTAG. Deletion right flank: AAGTCCCATGGAAGATCTCCATAGAATTTT. Insertion Sequence: TTGGTCATCAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (ok3432) in T09A5.8, detectable by PCR using the following primers. External left primer: CTTCCTTCGACGACTTTTCG. External right primer: CCGGGGAAACTGAGTCTCTT. Internal left primer: AGTGGCGGAGTTGGTCAT. Internal right primer: AGAACTTCGGAGCGTCGTT. Internal WT amplicon: 1373 bp. Deletion size: 475 bp. Deletion left flank: ACCGTAGCTACCGTCGCTGTCATGGTTAGA. Deletion right flank: AAATAAGACGGAATTTTCAAAAGAAAACTC. Validation: ok3432 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.8. Identified by PCR, validated by CGH. External left primer: CGAATCGATCCGATCTTCAT. External right primer: GGGATCGATAATGGCTCAGA. Internal left primer: GTTTCCGGAGTTGGAACTGA. Internal right primer: TTGCGAACAACAAATCCTCA. Internal WT amplicon: 1279 bp. Deletion size: 764 bp. Deletion left flank: AAGAAATCAACACAATTTAATGTTAAAGAT. Deletion right flank: GAACCCGCTCTCTACGCTCCGCGAGCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK418.13. External left primer: CGCGCTTTATTGAGAACCAT. External right primer: TTTCCGAGGGTACGCTTCTA. Internal left primer: GCGCGAAGTTTGAATAGGAC. Internal right primer: GCGGCCACGTAGTAGAAAAA. Internal WT amplicon: 1264 bp. Deletion size: 446 bp. Deletion left flank: GACGGAGGCGATACGGGCGGTGGCTTCATG. Deletion right flank: GCATGTTTGCTCATAGAGCTTACACCACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G8.5. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3268 homozygotes. Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTTGAGTGTGTTGTTGCGA. External right primer: GCGCACATCCTTTTTCATTT. Internal left primer: ACAATCAGGGATTCCGTTTT. Internal right primer: TGGATGGAACATTTTGTGGA. Internal WT amplicon: 1263 bp. Deletion size: 528 bp. Deletion left flank: TTGTCTTGTAACAGTAGTCTGTCTCTCGAC. Deletion right flank: GTTTGTTGATACGGAGTCGTGGAGCGTAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G8.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3269 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTTGAGTGTGTTGTTGCGA. External right primer: GCGCACATCCTTTTTCATTT. Internal left primer: ACAATCAGGGATTCCGTTTT. Internal right primer: TGGATGGAACATTTTGTGGA. Internal WT amplicon: 1263 bp. Deletion size: 1068 bp. Deletion left flank: GAAAACATTTAAAAAAATGTTTATCAAAAA. Deletion right flank: CATTTTTTCGATTTTTTTTTCAGCGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Identified by PCR, validated by CGH. External left primer: GGATGCTAGTTTGGAGAGCG. External right primer: AACAGCTGACAAGGAGCGAT. Internal left primer: GTGAACCATCCGATTATGCC. Internal right primer: AATTCGAGAAGAACGATGCG. Internal WT amplicon: 1747 bp. Deletion size: 767 bp. Deletion left flank: CGTTATTCAGCCGCAAAATTAGAGAAATCT. Deletion right flank: AGACATTCAGCCAGCATATCCATATTTCCA. Insertion Sequence: CGACTTTCGCGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03A8.1, M03A8.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H27M09.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3341 homozygotes (grotty, lumpy sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTAGGTGAACCCACGAGCAT. External right primer: TGGATCAATCGTCTCCTGCT. Internal left primer: ACAGTCACGGGAAAACAGGA. Internal right primer: TGAACTTTGATATGCAACACAGAA. Internal WT amplicon: 1195 bp. Deletion size: 691 bp. Deletion left flank: TCAGCCACGCTCGTCGTATTGCCATCGCAG. Deletion right flank: ACCACCAGGAAAGAAGGGAGATGATGGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01E11.7. External left primer: GGTTGCTCAGGTTCAAGCTC. External right primer: TGAAATTGTTGGCGTGTGTT. Internal left primer: AACACCTTCCGCGTGTTATC. Internal right primer: CGTCCGTGATTCGAACTCTT. Internal WT amplicon: 2173 bp. Deletion size: 1514 bp. Deletion left flank: TCAAGTGGTACGTGATTGGATTTTGTACTA. Deletion right flank: CCATATGGTTTCCCTAAACTCACCTCATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01C3.10. External left primer: CGTTACTTTTCTCGCCAAGG. External right primer: TCGTGCAAAAGTGAAGATGG. Internal left primer: CTTGCACTGAACAATGTCGC. Internal right primer: CCATATTGGGACAATGGGAA. Internal WT amplicon: 1286 bp. Deletion size: 597 bp. Deletion left flank: TACAATTATTGAAATTCCAGTATCCAAAAA. Deletion right flank: GCTCCCTGAGGTGGATTGGCCTTTTCGCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19D12.5. External left primer: TCCACTCAAGATGACACCCA. External right primer: CACATTAGGCCAAAATGCCT. Internal left primer: CGGCAAACTTCTGGAACAAT. Internal right primer: ACAATCCCAGCATCCGTATC. Internal WT amplicon: 1654 bp. Deletion size: 685 bp. Deletion left flank: ACAACTTCTTCTGATTTTTCAAGATGTTTC. Deletion right flank: TCCACCTTTTCCAATCAATCCCTCAATCAA. Insertion Sequence: AAGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46G11.1. External left primer: CCTTCTCCAAGACTTGACGC. External right primer: TACCCAGCGTATTGCACAAG. Internal left primer: TTTCCGTTTTCAGCGCTACT. Internal right primer: TCTCGAAACTGCAGAACAGC. Internal WT amplicon: 1253 bp. Deletion size: 849 bp. Deletion left flank: GTAAGTAGAAATTCCGATGTCTTCCTTCAT. Deletion right flank: TTTAAATTTTAGCATTAGCTGAGTTTTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54F11.2. External left primer: AGTGGTACTGTAGGCCGGTG. External right primer: TCGGAGATCATAGGGCATTC. Internal left primer: TCCTACGCCTGTGGAAACTT. Internal right primer: TTGCATAGGCCTTCTGCTTT. Internal WT amplicon: 1216 bp. Deletion size: 472 bp. Deletion left flank: AGGATCCAACTTACCAGACCACTATCAATA. Deletion right flank: CTATGAGCAGAACATTGCAGTCAAGTACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42D1.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3323 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTCCCCCAAAACTTCATTCA. External right primer: CAAGTGAGCACAACTCGGAA. Internal left primer: AACGTTCTCCCACAATCAGC. Internal right primer: AGCTTGTCCTGGTAGGCAGA. Internal WT amplicon: 1155 bp. Deletion size: 602 bp. Deletion left flank: TGCTCACATGCTCTTCAGATGGCTATTGAA. Deletion right flank: TAGCATCTTGGCTGATGTTCCAGGAATGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H28G03.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0252.1. Identified by PCR, validated by CGH. External left primer: GTGTCGCCTTCTGTGGTACA. External right primer: ATGGGCTGGAACTCTTCCTT. Internal left primer: CGGACTACGCTCCTCTGAAC. Internal right primer: TTGGAATGGAATTCTGCTCA. Internal WT amplicon: 2463 bp. Deletion size: 1236 bp. Deletion left flank: CTTTCATATGCAGATGACTTGACTCCATTG. Deletion right flank: TTTTAAATGTTTTCTACGGTATTTGACCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC581.1. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3240 homozygotes (slow-moving Unc, may be sometimes sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGTGGTGCTTTTGGAGTT. External right primer: TCCGCTGTTTGACCTACAGA. Internal left primer: CTGTGTCGCGGTAAAAATGA. Internal right primer: GCATGACGTCGATGGTTTC. Internal WT amplicon: 1365 bp. Deletion size: 602 bp. Deletion left flank: CTTTTTACTGAAACAAATATTTTTGAAGAT. Deletion right flank: CTTTCCGATCCACTTGTTCTTCCCTATTTG. Insertion Sequence: GTAATCGATTAATTTTCAGAGCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25D1.4. External left primer: TCAAGGAAGCATCCGAAGTT. External right primer: CCACGGATGAATCGAGTTTT. Internal left primer: TCAGATTTTTGGAGTTTCCGA. Internal right primer: TTATTCGATTTTCCCCGTTG. Internal WT amplicon: 1152 bp. Deletion size: 915 bp. Deletion left flank: TTTTGGAGTTTCCGATAATTTCCATGATGT. Deletion right flank: TTCAGTGATAAATTTTCAAATTTCTCGAAA. [NOTE: (05/10/2022) This strain also carries an (A to T) missense mutation in rpm-1 which results in a Q3089H amino acid substitution in RPM-1. See Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05C4.1. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3318 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAATCACTCGACTGGGTTG. External right primer: TCCAGATTCACGGATTCTCC. Internal left primer: TATCTCTGCCGAGCTCATCG. Internal right primer: CAATTTTCCCCCATTTGTTG. Internal WT amplicon: 1314 bp. Deletion size: 725 bp. Deletion left flank: ATATCTCTGCCGAGCTCATCGGCAAACTCG. Deletion right flank: ATCTCCGATGTCCAAGATCTTCATGACCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1248.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3390 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTCGTCGTTTTTCATC. External right primer: AGTGAATTTCGGTCAATCGG. Internal left primer: GCGCTCAGGATAATAGAACAA. Internal right primer: TTCTGTTTGAATTCCTCGCA. Internal WT amplicon: 1190 bp. Deletion size: 590 bp. Deletion left flank: ATTTTGGTTCCTTACTGTTTGTTAGAGCTT. Deletion right flank: GAAACCAGTAAGTGATAATTTCCTTTTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E8.6. External left primer: TGCTCTTCGTATGTTGGCAG. External right primer: CAGGCCCAGAAATTTCGTTA. Internal left primer: TCAGACTGTGTCGTTGGAGG. Internal right primer: TTTGCATCCTATGATGTGTGC. Internal WT amplicon: 1218 bp. Deletion size: 407 bp. Deletion left flank: AGGGAATAATTGCTCACGAACTGATGCACG. Deletion right flank: GTGTCAAGTACGACGACTACAACTAAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.16. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3353 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCTTTCGTCTCTCTTCGGA. External right primer: GGCAACACTCATGCTTCTCA. Internal left primer: TGGCTTTTTCCGTTGAAACT. Internal right primer: CTTGGACAGGAAGGTGTTGG. Internal WT amplicon: 1340 bp. Deletion size: 442 bp. Deletion left flank: GCATCTCACTAAATTTTTTATTTTTCAGGG. Deletion right flank: GCCACCCAGTTTAATTATTTTGAGAGTAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y8G1A.2. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok236 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06C7.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3383 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAGACGTTCGCAACGTAAG. External right primer: GGACGCTCCTGTGTAATGGT. Internal left primer: GCGGAATTATACGACTGCGT. Internal right primer: CACAGAGCACGGAAAAGTCA. Internal WT amplicon: 1253 bp. Deletion size: 652 bp. Deletion left flank: AGAATGTGGAAAAGATCAAATGCTGGAGGA. Deletion right flank: TGAGAATCCTCCAGCGACAGTGACACTTTC. Insertion Sequence: CTTCGGAGCAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52F12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3339 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATATGCCTCGTCCTGGAAC. External right primer: GGCCATGTTCATCAGAAGGT. Internal left primer: TTTCTTTACCACGAAGTAAGCG. Internal right primer: TCTGAATGTTTGAAAGTCGCA. Internal WT amplicon: 1354 bp. Deletion size: 696 bp. Deletion left flank: CATTGAAGTAGAGGCCAAACAACGAAATAT. Deletion right flank: TCTGAATTAAAAATGCTTAATTCAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3221 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 303 bp. Deletion left flank: ATCCCGTTGGATGGGAGAATATTCAAATTA. Deletion right flank: ATCGTTATCAATGTAGACATCTTGCTCTTT. Insertion Sequence: TTGTAGTGAGACCGGAAGCTGAAGGAGATGGATCATGCTCTGATGCTCCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27F2.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1091 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATAGAGACCCGGATGCAAA. External right primer: AACAGGTCCAGATCCACGAC. Internal left primer: CTCACAAACCGCCATGATTA. Internal right primer: TGAACCAGAACGGACATGAA. Internal WT amplicon: 2496 bp. Deletion size: 1422 bp. Deletion left flank: ACAAGTTAGCACCTGCTCAATATATCAGAT. Deletion right flank: ACAAAACTCTTTGATGATACTGATGTATTT. Insertion Sequence: GGAGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32D1.2. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGAATCCGAAGGTGTCTC. External right primer: GCAGCCCAGTCTGTGTTGTA. Internal left primer: GATCATCGTTATTTTCGCCG. Internal right primer: TATAGAGCCGGGCTGAAATG. Internal WT amplicon: 1263 bp. Deletion size: 791 bp. Deletion left flank: AATGTATCCAAATGGAATTATTCGAATACT. Deletion right flank: CTGGTGGGTCTCGCAACGACATGAAGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33G12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3435 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGTCCGATTTTGCAGCTTG. External right primer: TCCCCAGTGCTCTTTTATCG. Internal left primer: AACCATTTGATCATTGGCATT. Internal right primer: CCATGTGAAGTGGTTTTTGC. Internal WT amplicon: 1116 bp. Deletion size: 563 bp. Deletion left flank: AGGCTTTATCAGGTCTCCGTAAATCGATAG. Deletion right flank: GATTAACTCCGGCATTTGCTTTATAACGTG. Insertion Sequence: AC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08C6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok547 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CGATAACCGAAGACTTTCGC. External right primer: CCGTGTTTCCAACCAAATCT. Internal left primer: AGCGTTGCGCTTATCAATTT. Internal right primer: GGCGATAGGAACCAGTTGAA. Internal WT amplicon: 2670 bp. Deletion size: 2114 bp. Deletion left flank: TCAAAGAAAATAACTTTGGCAATGGCAGAA. Deletion right flank: ACAGGAACGACAGAAAATGTATCCGTATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2187 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAGCCTTTTGAGAAACACG. External right primer: CATAAGAAAGCTTCGCAGGC. Internal left primer: CCCTGCCACTGTGACAATTA. Internal right primer: GGAGCCAAATGGAAGAAACA. Internal WT amplicon: 3170 bp. Deletion size: 1128 bp. Deletion left flank: ATACTGCCTGTGCGACTCCAAATGCCAACT. Deletion right flank: AGTTTTTCAGAAATTAAAAAACCTTTATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41G9A.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13A5.9. External left primer: TTCACTTCCACCACCACCTT. External right primer: TTTCTGGACCATTTTGGAGC. Internal left primer: ATTCTCGCCCTTGCTTTCTC. Internal right primer: AATTTGCCAGTCGTTTCAGG. Internal WT amplicon: 1266 bp. Deletion size: 518 bp. Deletion left flank: GGATGATTTCGGAATGTATCCGAATAATCG. Deletion right flank: CGCTGAAATTAAAATAATTTATTTTGAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F11.4. External left primer: GGAGCGAAGAAAGAGGGAGT. External right primer: GTGCATGCGCCTTTAAGTTT. Internal left primer: GCAGAAATTAATGGGGTGGA. Internal right primer: GCGTCGAGTTGTGTGTTTTT. Internal WT amplicon: 1248 bp. Deletion size: 294 bp. Deletion left flank: TTTTTTTTTATTAAACAATAAAAAATGTAT. Deletion right flank: TCAAATTTTCAATTTGTTTCTAATATATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1105) in T22E7.2, detectable by PCR using the following primers. External left primer: GAAGGTGTGAAAAGACGGGA. External right primer: TGCAGGAAAAGCAACAAGAA. Internal left primer: TGGTCTGTAGAGCCCATTCA. Internal right primer: GTGTTGGAGAAACGTGGGAT. Internal WT amplicon: 2319 bp. Deletion size: 568 bp. Deletion left flank: TGATATTTTACTGATAATTATACACTTTCA. Deletion right flank: CTTCAAACATACGCTTCATCTTTTCGCGAA. Validation: No CGH probes for gk1105. Other deletions (gk3222, gkDf33) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C35E7.10. External left primer: AGTGGCTTTGCTGCAAGATT. External right primer: TTTCATCGGCTTTTATTCGG. Internal left primer: GCGAGTTTGACCGTTTCATT. Internal right primer: AAAGCCAGATCTCGGTTGAA. Internal WT amplicon: 2691 bp. Deletion size: 1321 bp. Deletion left flank: CTTCATTGGGAGACGATCCTCATACTTTTC. Deletion right flank: TCCAAATGCTCCCTCTCCAAGCTTCTTCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23C8.8. External left primer: ATCCTTTGATGTACGCCGAC. External right primer: TTTTCCAAAGCGTGAGACCT. Internal left primer: CACAGTTGGATGAATTGGGA. Internal right primer: TGAGTGAAATGAGGAGTGCG. Internal WT amplicon: 2558 bp. Deletion size: 907 bp. Deletion left flank: GACAACTGCAAAGAAAATCGAGATATGAGC. Deletion right flank: GTCCAAAGTTGAACTCATTATCGATGCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04G3.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CACCAGATGCACCAACATTC. External right primer: GCAATTACTTTCCGGTTCCA. Internal left primer: CACCAGGAACTGACGACAAA. Internal right primer: ATCATGTTGAAGGCCTTGGT. Internal WT amplicon: 1143 bp. Deletion size: 578 bp. Deletion left flank: AGTATCTATGTAAATCTGCTGAATGAAATA. Deletion right flank: GAAGGAAATCCAAATGGATCCCCAAGATAT. Insertion Sequence: AG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40E10.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ok3356. Homozygous constitutive dauer deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3356 homozygotes (constitutive dauer, probably non-recovering). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCCAAGAAGTGAAGATTCC. External right primer: ACGCTTGTAATGCCGAAAGT. Internal left primer: GCAAATGCTTCAAAAGAGCC. Internal right primer: GAGTCCGAGCAATTCTGAAAA. Internal WT amplicon: 1122 bp. Deletion size: 367 bp. Deletion left flank: AGGAACATTTCATCCGTATGGTCGTTTCTA. Deletion right flank: TTTGGAGGATTAATCGAGTTTTGAAGGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02E12.8. External left primer: GACATTTGACGGTTCCGTTT. External right primer: GCGAAATTGTGCATTTCTTG. Internal left primer: CGATCCGTAACTTGGAAACAA. Internal right primer: GAATTAGGAGCACACGACCA. Internal WT amplicon: 1151 bp. Deletion size: 418 bp. Deletion left flank: TTGCTTCTCATGAAACGTCCAGGAGTGTTC. Deletion right flank: AAGTGCATAGATGATGCAAAACTCAGAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3370 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCTAGTAGCGAAATG. External right primer: CAATTTTGGAATTCCTCCGA. Internal left primer: CTCTTCTTGTCGGCCTTGTC. Internal right primer: CCTCAATTCCGCACTCGTTA. Internal WT amplicon: 1101 bp. Deletion size: 337 bp. Deletion left flank: TTACAAGCCATGCCCATCCAACATGTACCC. Deletion right flank: GTTAACGAGTGCGGAATTGAGGGAGGAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28F8.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3431 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAATTCCCTCTCACAA. External right primer: TTTCCAGGGACGATCTGAAC. Internal left primer: CTGTTGGGTCTCGGAACTGT. Internal right primer: CAACACGTGCTGAATATGATCC. Internal WT amplicon: 1270 bp. Deletion size: 509 bp. Deletion left flank: TGTACAACGACACTCCGAAATGACGCATAG. Deletion right flank: CATCGGCTCGAAAATCTGGGTGATAATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807