| VC2846 |
C. elegans |
T09B4.7(gk1215) I; npp-9(gk3059) III. Show Description
T09B4.7, F59A2.1. The allele gk1215 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CGTCTTTCACTCGCCTTTTC. External right primer: CAAAATGGAGAGTACCCGGA. Internal left primer: TATTCTGTATGACGCCGCAC. Internal right primer: CCGGCCTGATCTGAGAGTAA. Internal WT amplicon: 2551 bp. Deletion size: 661 bp. Deletion left flank: AAAGAAATAAAGCTCCAGATGATATCACGT. Deletion right flank: GGAAAGCAACTTATCATTTCCCATACCAAC. The allele gk3059 was identified by CGH but not confirmed by PCR. Left flanking probe: TTCCATTCTCAATATTTGAAGGGAGTGTCTCCTCCGAAATGGTCACCTGG. Right flanking probe: CAGAACATGGTTTGCTCTCCTTCTTCTCCAGTTTTCACCTCGACAAGATC. Left deleted probe: GTCTCCTCCGAAATGGTCACCTGGTCTCGTCGCATAACAACTCTCCACGA. Right deleted probe: CGTTGGCATAAATGTAGAGTTTTGAACGATTGCAGAACATGGTTTGCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC285 |
C. elegans |
ppm-1.A(ok578) V. Show Description
F25D1.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2853 |
C. elegans |
+/mT1 II; pst-2(ok3603)/mT1 [dpy-10(e128)] III. Show Description
F54E7.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3603 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGCATAACACGAAACGAA. External right primer: ACCCGAGCCCTGATAAAAAG. Internal left primer: GCGATTTGTGCGTCAGTAAA. Internal right primer: TTTAAGTTCTAAACCGTCATTGG. Internal WT amplicon: 1236 bp. Deletion size: 437 bp. Deletion left flank: ACTTTCGAATGCATCCGTTGGATATTTAAA. Deletion right flank: CTACGCACTGATCCTCTCATGTCTTGGATA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2854 |
C. elegans |
H43I07.2(ok3654) V/nT1 [qIs51] (IV;V). Show Description
H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2857 |
C. elegans |
F45H11.6(gk1216) I; F09A5.2(gk3060) X. Show Description
F45H11.6, F09A5.2. The allele gk1216 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 646 bp. Deletion left flank: GATGAAGAATGAGAAAGGAAATATTTGAAG. Deletion right flank: AATAATGTTGTCTGGTACAGGTATCAAATC. The allele gk3060 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right flanking probe: TGGTGAGTGACCTTTCCATAAACCGAATTACCTCGGAAAATGTTTTTAGA. Left deleted probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right deleted probe: GAGAAGACATAAAGATTATGTGCTGATGGTGAGTGACCTTTCCATAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2858 |
C. elegans |
C40D2.4(gk1276) II. Show Description
C40D2.4. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 518 bp. Deletion left flank: TCTCCTCAAATGCTGAAAGTGAATAAAGAA. Deletion right flank: CAAAAAATATTTTTCAAAAGATAACATAAA. Insertion Sequence: AGGTGATCTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2859 |
C. elegans |
R09D1.13(gk3177) II. Show Description
This strain is homozygous for a deletion (gk3177) in R09D1.13, detectable by PCR using the following primers. External left primer: GCAATCGGGATGTTCTGAAT. External right primer: TGTTGGAGAAACTGTGCGAG. Internal left primer: ACAACGAAACATCGTCGGAT. Internal right primer: ATAAATATGGATGCCGCCAA. Internal WT amplicon: 2530 bp. Deletion size: approximately 1400 bp. Validation: gk3177 passed by CGH. Left deleted probe: AGGATCAATTTCGACTGGAATGTTGCCTATACTAATATTATCTCGAATGC. Right deleted probe: AATTAATATAACTAGATCCATTGCCATTTTCGGTTTGGCTGGAACATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC286 |
C. elegans |
+/szT1 [lon-2(e678)] I; pgp-7(ok528)/szT1 X. Show Description
T21E8.2. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok528 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2860 |
C. elegans |
K09E4.1(gk1223) II. Show Description
K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2861 |
C. elegans |
coel-1(gk1236) X. Show Description
C52B9.3. Identified by PCR, validated by CGH. External left primer: ACATTTTTGTGGCCTTTTCG. External right primer: ATTCCCTTCTCATCCCTGCT. Internal left primer: TTTTCACTTGTCCCTCGACTTT. Internal right primer: TCGTTGAATGTATTTGCAGGTC. Internal WT amplicon: 1349 bp. Deletion size: 448 bp. Deletion left flank: AAATGTGTGCTCAGTTTTTGTTTGCGAAAA. Deletion right flank: TATCAGGTTTGTAGATCACGTTTTCCACTA. Insertion Sequence: CCCTTTAAAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2862 |
C. elegans |
+/szT1 [lon-2(e678)] I; utx-1(ok3553)/szT1 X. Show Description
D2021.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATGGATATCAGCGCTCAGG. External right primer: TTGCTACTTGCCAGCACATT. Internal left primer: CAAATGGTTCATAGAAGAACTCAGC. Internal right primer: CTGTTGAAAGTTGAGTGGCG. Internal WT amplicon: 1147 bp. Deletion size: 554 bp. Deletion left flank: GACAATAGGAAGGAAGCTCAAAGTCTGGAA. Deletion right flank: TGGGGCACCAAGTTCACGGCATGAATACTG. Insertion Sequence: AGTCTGGAAAGTCTGGAAAAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2864 |
C. elegans |
Y75B8A.6(ok2294) III. Show Description
Y75B8A.6. External left primer: ACGGATCCCTGAACAGAATG. External right primer: TATATTCACGGGGTTCTGGC. Internal left primer: TTGCTGGAGAGAAAAACGGT. Internal right primer: GGAAACCAGAAATCCGTGAA. Internal WT amplicon: 3060 bp. Deletion size: 903 bp. Deletion left flank: ATACGAAAAAATTCAAAAATTCAAAAAGGA. Deletion right flank: TATATTGAACTCGTTTCACATCAAAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC287 |
C. elegans |
hmt-1(gk161) III. Show Description
W09D6.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2873 |
C. elegans |
R03A10.3(ok3439) X. Show Description
R03A10.3. External left primer: TGCTGGAGTAGAGCGGGTAT. External right primer: GCAGAGAGCCTGAAAATTGC. Internal left primer: CCTTGTGGAAGGCCTTGTT. Internal right primer: GCACAGCCCTGATTCCTACT. Internal WT amplicon: 1181 bp. Deletion size: 621 bp. Deletion left flank: CAGTTTTTTTCCGTTTCACTTACCACATCG. Deletion right flank: CCCAACTACAGAATGATGCGAATCGTAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2876 |
C. elegans |
egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2878 |
C. elegans |
F29B9.2(ok3628) IV/nT1 [qIs51] (IV;V). Show Description
F29B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3628 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGCTTATCAAGCACACGA. External right primer: AACCGCGTGAAAGAATATGG. Internal left primer: CATCTCCGGACACCACTACA. Internal right primer: GCTTCTTCATGAGGCGATCT. Internal WT amplicon: 1193 bp. Deletion size: 823 bp. Deletion left flank: ATCAAGGAAGGTCAGACACTGCTCATCCCG. Deletion right flank: ACTATTGTGGATCCCATCTCGAAGCACGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2879 |
C. elegans |
glb-3(ok3630) V/nT1 [qIs51] (IV;V). Show Description
C06H2.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3630 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGTGAACAAATGGGCAA. External right primer: AATGCGATTGAGATGAAGCA. Internal left primer: TCGAAGAATGAGTCGAGCAA. Internal right primer: TGGACCTGAAAACCAAATGA. Internal WT amplicon: 1341 bp. Deletion size: 975 bp. Deletion left flank: ATTCCTAAAAACGAATTAACCCAAAGTTTG. Deletion right flank: AATGACAGTCTAGGTGTATCTAGAAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC288 |
C. elegans |
dac-1(gk198) III. Show Description
B0412.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC289 |
C. elegans |
prdx-2(gk169) II. Show Description
F09E5.15. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2896 |
C. elegans |
F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I. Show Description
F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2897 |
C. elegans |
gpi-1(ok3599)/hIn1 [unc-101(sy241)] I. Show Description
Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC290 |
C. elegans |
atrn-1(gk163) X. Show Description
F33C8.1. Often Dpy with vulval blip. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2901 |
C. elegans |
F52C12.2&F52C12.6(gk3019) IV/nT1 [qIs51] (IV;V). Show Description
F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC291 |
C. elegans |
tag-51(ok474)/sC1 [dpy-1(s2170)] III. Show Description
K02F3.1, K02F3.12. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok474 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2913 |
C. elegans |
cTe154X.1(gk3136) III; flp-10&T06C10.3(gk3137) kin-26(gk1263) IV. Show Description
T06C10.4, T06C10.6, T06C10.3, cTe154X.1. The gk1263 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 1036 bp. Deletion left flank: ACAAAATAAACGAGTTTAAAAAAACATTCA. Deletion right flank: TAACAAGGTACAATGGTTCCTGTAGTACTC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2914 |
C. elegans |
C40D2.4(gk1252) II; Y102A11A.2(gk3151) X. Show Description
C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATA TGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTAT ATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTA TATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2916 |
C. elegans |
F45H11.6(gk1242) I. Show Description
F45H11.6. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 572 bp. Deletion left flank: GAAATATTTGAAGTAAAAATAATAATACAT. Deletion right flank: TTGAATGCCAGTTTTAAGGCACACACTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2919 |
C. elegans |
clec-198(gk3149) IV; W03G11.3(gk1251) X. Show Description
C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC292 |
C. elegans |
+/nT1 IV; sun-1(gk199)/nT1 V. Show Description
F57B1.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk199 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2921 |
C. elegans |
F55G1.5(gk1250) IV; pgp-10(gk3148) X. Show Description
C54D1.1, F55G1.5. The gk1250 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACGTTGCGAAGTAGATGA. External right primer: GCGGTACAACGATTGAAGGT. Internal left primer: TCGTTGCCTGTTGTATGGAA. Internal right primer: CCGATGAAATGGCAAAATCT. Internal WT amplicon: 1387 bp. Deletion size: 621 bp. Deletion left flank: AGTCGTAATCACCACACCAATGGAGCTATT. Deletion right flank: TGCGTCGGTTTCGCCTAGAGCATTTATTTT. The gk3148 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2928 |
C. elegans |
C35D6.4(gk1282) IV. Show Description
This strain is homozygous for a deletion (gk1282) in C35D6.4, detectable by PCR using the following primers. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: AGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Validation: gk1282 passed by CGH with low log2 scores. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2929 |
C. elegans |
F56H6.6(gk3146) I; Y38F1A.1(gk1246) II. Show Description
Y38F1A.1, F56H6.6. The gk1246 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACCCCATTGTTGAACTTT. External right primer: ATGCCACGTAGCAAAAATCC. Internal left primer: TTCCCAAACACAAGAATCCC. Internal right primer: GCTAAGAGATATCGCGCGTC. Internal WT amplicon: 1616 bp. Deletion size: 617 bp. Deletion left flank: GCTCGACAGGGTTGACATGCCAGAACGCGT. Deletion right flank: TCCCGGTGATTGTAAGGTCTTTAGACATAT. The gk3146 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2930 |
C. elegans |
C40D2.4(gk1258) II; sru-36(gk3145) V. Show Description
R07B5.6, C40D2.4. The gk1258 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 942 bp. Deletion left flank: ATGAGTGATTTACTTTTAAAACTTGAAAAT. Deletion right flank: ATATGTATATGTATATGTATATGTATATGT. The gk3145 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2931 |
C. elegans |
coel-1(gk1284) X. Show Description
C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 182 bp. Deletion left flank: ATCATACCGAACTGCGGTCCTGCTGCCTGT. Deletion right flank: GCCAGAGAGCCCTAGAACTTCTTGTGCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2932 |
C. elegans |
coel-1(gk1274) X. Show Description
C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 268 bp. Deletion left flank: TCCCACCGGACGGCGCACGCAACAGCCCGT. Deletion right flank: TTTGAAATTCAAACTGATCTTCTAACAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2933 |
C. elegans |
C35D6.4(gk1281) IV. Show Description
C35D6.4. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: TGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2934 |
C. elegans |
F38C2.7(gk1244) IV. Show Description
F38C2.7. External left primer: TGCTCCAGTGTGCACAAAAT. External right primer: TTCACAGAGAGTGTGGCCTG. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: TGTTGAAGCAAGCAACCAAG. Internal WT amplicon: 598 bp. Deletion size: 392 bp. Deletion left flank: CACCTGATTCCGTACTTGCAATGCCCAGTT. Deletion right flank: TTCTTGGTTGCTTGCTTCAACAGACATTGT. Insertion Sequence: CTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2935 |
C. elegans |
gcy-27(gk1267) IV. Show Description
C06A12.4. External left primer: CTTCCGAAAAAGCTGTGGAG. External right primer: TCGGTTTTAGGTGCAGCTTT. Internal left primer: TTGCAATTGCGTTTCGTAGA. Internal right primer: TGCATTGATACCTTTCGCTG. Internal WT amplicon: 2701 bp. Deletion size: 1198 bp. Deletion left flank: TTGTGACCCCATATAATGCAATTTTCAGTA. Deletion right flank: CCGATACTTGATGAGTATGTTCACAACTAC. Insertion Sequence: GGTGACACTGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2936 |
C. elegans |
kin-26(gk1261) IV. Show Description
T06C10.6. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 783 bp. Deletion left flank: CGGCTTGATCTGATAAACAGTTCCATTTCG. Deletion right flank: GATTGACTAGCATACAACCTTCTTTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2937 |
C. elegans |
unc-38(ok2896) I. Show Description
F21F3.5. External left primer: TGTGATTTGTTGCGTTTGGT. External right primer: ACATCACCGAACAAGCCATT. Internal left primer: TGGCAAAATTTGGCTGAAGT. Internal right primer: TAAAGCTGAAACTCCGCCTC. Internal WT amplicon: 1313 bp. Deletion size: 796 bp. Deletion left flank: TTATTCAAACTTTGCAACTTCTCGTGTTTC. Deletion right flank: CATCTTACATCAATTTGACACATACTCTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2939 |
C. elegans |
Y39A1C.1(gk1241) III. Show Description
Y39A1C.1. External left primer: GGTAATGCCGTCTGGAAATG. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: CCATTCCCTGAAGTTGCAGT. Internal right primer: TGAGCCAGTATGACGTGAGC. Internal WT amplicon: 935 bp. Deletion size: 413 bp. Deletion left flank: CACAGAAACGTGGAATTTCTCTCCCCAGTC. Deletion right flank: GATTTTTCAAGCAATTTTCAGTAGAAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC294 |
C. elegans |
sdhb-1(gk165)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F42A8.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- gk165 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2942 |
C. elegans |
+/mT1 II; B0285.1(ok3664)/mT1 [dpy-10(e128)] III. Show Description
B0285.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3664 homozygotes (arrest stage/phenotype undetermined). Note: mT1 may have acquired an early lethal in this strain, so mT1 homozygotes may not be seen. Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACATTCATTTTGCCGCTA. External right primer: TCCTTCTCCCATAGTCGTGC. Internal left primer: CTTAGCTCCATACCACCACCA. Internal right primer: CTCGCCTCTGCAAACAATTT. Internal WT amplicon: 1354 bp. Deletion size: 632 bp. Deletion left flank: GATAGCCACTCGGCCTGTGTAAGTTATTTG. Deletion right flank: TTCATCATAAGAATATCGTCCGTCTTATGG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2948 |
C. elegans |
frm-2(ok3690) III. Show Description
frm-2. Homozygous viable deletion, detectable by nested PCR. External left primer: AGAGGGGAATATCCCGATTG. External right primer: AGAACAATGGCCAAATCCAG. Internal left primer: GTTGCATTGGGGGAACAATA. Internal right primer: CGTTCGTTTTTCACTTGACG. Internal WT amplicon: 1105 bp. Deletion size: 411 bp. Deletion left flank: CCTGGAAAGTTTATGGAGTATTTGAAAACA. Deletion right flank: ATTTTGCATGGGTTCGCTGTTGATCATTGG. Insertion sequence at break: AAAACCTTGTATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC295 |
C. elegans |
unc-30(ok613) IV. Show Description
B0564.10. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2950 |
C. elegans |
Y108F1.5(ok3700) X. Show Description
Y108F1.5. Homozygous viable deletion, detectable by nested PCR. External left primer: CACAGCTGAAACCGATGCTA. External right primer: GCCACCACTAGGGAAATTGA. Internal left primer: TCAGGGCATGATGAGAGTCA. Internal right primer: TGGATCAATTTTCAGCCACC. Internal WT amplicon: 1261 bp. Deletion size: 839 bp. Deletion left flank: TTTTTGAAAAACCTACTAATGCCCGCGACT. Deletion right flank: ACTGTAGCCCCAAAAGTACGCAAACACGGA. Insertion sequence at break: CTACCCTAAGAGTCCAGTTTTCAGGTTTCTAGTCGAATTTCGACCAGAATCGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2953 |
C. elegans |
C46H11.3(ok3704) I. Show Description
C46H11.3. Homozygous viable deletion, detectable by nested PCR. External left primer: AATTTTACACCCCCTCCAGC. External right primer: GGAGTCTCCGATTGTCCAAA. Internal left primer: GTCCTTGTTTTTGTTGGTTTTT. Internal right primer: AGCTCAATGCCCACTCACTT. Internal WT amplicon: 1318 bp. Deletion size: 391 bp. Deletion left flank: AATTTTTGAATAAATAATAATATTTCAATA. Deletion right flank: CAGGGATCCATTGTTCGAGTGTTGTCCAAT. Insertion sequence at break: GGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2957 |
C. elegans |
rlbp-1(ok3695) I. Show Description
rlbp-1. Homozygous viable deletion, detectable by nested PCR. External left primer: CTGCTTTCCCGTTTCAATTC. External right primer: CTGCAAATGTGCCCTATTGA. Internal left primer: CTATGCCATCCTTTTCTGGC. Internal right primer: TGAAAGAAATACAGTACTTTGTGAA. Internal WT amplicon: 1224 bp. Deletion size: 489 bp. Deletion left flank: TTCTGGCGCGGTGCCAAATTATAGAAAACT. Deletion right flank: GAACGAGGCCGAACGACAGCAGAATTGGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2958 |
C. elegans |
sqrd-1(ok3696) IV. Show Description
sqrd-1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCGTTGTCCTGCTCTTTTT. External right primer: CCTGTAATGACCCACCATCC. Internal left primer: CCAGATATCATACAAACCCCG. Internal right primer: CCAGTTTTATCGACAAATGCC. Internal WT amplicon: 1346 bp. Deletion size: 850 bp. Deletion left flank: GAAATCCGCGGAAGCTATTTTGTACCAGAT. Deletion right flank: CGTTTCCAATAAATCGTTAAAAATAAAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2960 |
C. elegans |
C50F2.3(ok3662) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C50F2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3662 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATGGCCGACAAAGAAAATG. External right primer: TTTTTCCAACTTTTCCGTGC. Internal left primer: ATGCCGAACTCTGAGACGAT. Internal right primer: AAAAGTTGGCGAAATTGGTG. Internal WT amplicon: 1186 bp. Deletion size: 656 bp. Deletion left flank: TGGAGAGCACTCTGTGACACTTATGAGAGA. Deletion right flank: CGAGAAGTGTCGATTATGATGCAAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|