Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CW152 C. elegans gas-1(fc21) X. Show Description
Hypersensitive to volatile anesthetics. Temperature sensitive hypomorph and should be propagated at or below 20C. Low brood size.
VC2605 C. elegans +/szT1 [lon-2(e678)] I; gas-1(ok3301)/szT1 X. Show Description
K09A9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3301 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATTCAAATCAGGGTGGAGG. External right primer: TGCCACTGAAAAGCTCATTG. Internal left primer: GCGCGTGTGGTCCTAATTT. Internal right primer: AAAATCTTCAACTCGGTCCAA. Internal WT amplicon: 1268 bp. Deletion size: 560 bp. Deletion left flank: TGTAAATTTAAAATTTTTTATATATAATAT. Deletion right flank: GCTCATCGATACGTTCTGGGAACTTGATGG. Insertion Sequence: CGATAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MCJ366 C. elegans mir-4812(cdb175) mir-1829b(cdb163) mir-1829c(cdb164) mir-1829a(cbd199) X. Show Description
Deletion allele of each microRNA. For mir-1829a, the entire intron is deleted to minimize disruption of host gene, gas-1. sgRNA #1: CGAGGACTGAAGGAGGAACG; sgRNA #2: GGAGGCGGAAGCTACCTGCG; sgRNA #3: GCGGTAACAGAGAGAACATG; sgRNA #4: GCTTCCTCGTCCTGCCGCCG; sgRNA #5: GTTTTCAAAACAGGGGGAGG; sgRNA #6: GCGACAGCAGAAAGAGCATG; sgRNA #7: GACGCAACCACTTTGGCCAC; sgRNA #8: ACGTGAGCTCTATAACTAAC; sgRNA #9: ATGGAACCGGAAAACCATAT; sgRNA #10: AGTGAGCAAACCCTGGAGCG; sgRNA #11: GCTACCATAGGCACCACGAG. Guide RNAs were injected in three rounds of CRISPR. sgRNAs #7-8 did not result in edits at the mir-1829a locus. sgRNA #11 was for co-CRISPR to mark jackpot founder plates.Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.
NC4085 C. elegans otIs355 IV; otIs846. Show Description
otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. otIs846 [egas-1p::GFP + unc-122p::GFP]. Pan-neuronal nuclear RFP expression. Co-expression of GFP and RFP in IL2 neuron can be used to isolate IL2 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH17217 C. elegans otIs846. Show Description
otIs846 [egas-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.