Search Strains

C33H5.14 Homozygous. Outer Left Sequence: tcccaagcctggttaagatg. Outer Right Sequence: tgccatcccaaacatcacta. Inner Left Sequence: ctgggtccatcatcactcct. Inner Right Sequence: ccactcctctccgtcttctg. Inner Primer PCR Length: 2936. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43F8C.10 Homozygous. Outer Left Sequence: ggctcctcgaacagattttg. Outer Right Sequence: catgacctccttgtttccgt. Inner Left Sequence: ataaggcagttttcgagcca. Inner Right Sequence: gctgttcttcaaggccaaag. Inner Primer PCR Length: 3320. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50B6.1 Homozygous. Outer Left Sequence: cctctcgtcgggtaacacat. Outer Right Sequence: gtggagtcgactgaagagcc. Inner Left Sequence: ggtgcttcagaatactcggc. Inner Right Sequence: accagccaaccattcacttt. Inner Primer PCR Length: 2105. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2092.3 Homozygous. Outer Left Sequence: tctccaatccgtttgaatcc. Outer Right Sequence: aagtgtgtcgcagcccttat. Inner Left Sequence: ttttcggcattttgtcagtg. Inner Right Sequence: cgcagagtaatcaaccagca. Inner Primer PCR Length: 2967. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B8A.26 Homozygous. Outer Left Sequence: tggttttgccctttttgttc. Outer Right Sequence: gcttcggctgcaataaactc. Inner Left Sequence: acgtcaatttccgtccactc. Inner Right Sequence: ttctgactcgtgaggtgtcg. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G8.7 Homozygous. Outer Left Sequence: ggaaaacaaaaccagggtca. Outer Right Sequence: cacgatcaagaagaatgcca. Inner Left Sequence: gaacggttgttcccagaaaa. Inner Right Sequence: cccgtgcagaggaatctaaa. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05F1.4 Homozygous. Outer Left Sequence: tgctgatgtagtcgacggag. Outer Right Sequence: acaataacccagacgcgaac. Inner Left Sequence: attcttggcaaagctcctga. Inner Right Sequence: gcaaaacttcgtgtttgggt. Inner Primer PCR Length: 2312. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31C3.6 Homozygous. Outer Left Sequence: ttcagctgattgaagcatcg. Outer Right Sequence: taaggcgcaggaaaacaatc. Inner Left Sequence: gggagctgtcgtccgtaata. Inner Right Sequence: tttacgttccgtccacaaca. Inner Primer PCR Length: 2843. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30A5.2 Homozygous. Outer Left Sequence: cttccaaatcagcagcaaca. Outer Right Sequence: tctggttgtcgaatgagcag. Inner Left Sequence: ttgcacaaatcgctaatcca. Inner Right Sequence: tgggagtcttgtagtgggct. Inner Primer PCR Length: 2227. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02A12.4 Homozygous. Outer Left Sequence: ggtttccaaaaagccaacaa. Outer Right Sequence: gtattcagaacgtggcggtt. Inner Left Sequence: tccatcaaaattggcaacaa. Inner Right Sequence: cggcgaaataaattttggaa. Inner Primer PCR Length: 2354. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

VZC374L.1 Homozygous. Outer Left Sequence: tttgcttttcgaggcatttt. Outer Right Sequence: tgaatcagcaagattgacgg. Inner Left Sequence: gcgtaaatttccggttacga. Inner Right Sequence: tcaagctctctgctcgactg. Inner Primer PCR Length: 2166. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48C5.1 Homozygous. Outer Left Sequence: ttgccttgcattcaattgtc. Outer Right Sequence: tgctgaatgagcttcttgga. Inner Left Sequence: agtcattcggaaagcgaaaa. Inner Right Sequence: agcagatgaagaaagccgaa. Inner Primer PCR Length: 2844. Estimated Deletion Size: about 1200 bp. Breakpoint data provided by Neline Kriek 10/2004: GATACAGGTTTTAAGAAAACACCACTTGAAAAACGCAGACAACGTAAGATTTAAAACAT GACTCGTTbreakpointAGTCTAGTGGTCTAGTGAACCAGTTTGCAATTTATGGTTTG AATATTTTAATTACTTTTAATAGTTTGTACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05D10.1 Homozygous. Outer Left Sequence: gcctccctcattcattttca. Outer Right Sequence: atcgggtggtctgttttgag. Inner Left Sequence: aataaaatttgccgctgtgg. Inner Right Sequence: gtcccgagttgttgtcgttt. Inner Primer PCR Length: 3047. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02H7.3 Homozygous. Outer Left Sequence: gtcaacgcgtgaaaaactga. Outer Right Sequence: cagcgtgacagatgcagatt. Inner Left Sequence: gctggagagtaaagttgccg. Inner Right Sequence: ccggtttcttgtagacccaa. Inner Primer PCR Length: 2891. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49G7.8 Homozygous. Outer Left Sequence: gccaaactttgctaacgctc. Outer Right Sequence: ttagccgaagtagccgaaaa. Inner Left Sequence: aagccttcagacacgctttc. Inner Right Sequence: gaccgattgattttagccga. Inner Primer PCR Length: 2372. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2096.12 Homozygous. Outer Left Sequence: aaacgaggagggaaacctgt. Outer Right Sequence: ttcatatgcaaaaccggtca. Inner Left Sequence: gatgagaacgcaacaagcaa. Inner Right Sequence: gggcggcaattaaaaacata. Inner Primer PCR Length: 3247. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08D10.3 Homozygous. Outer Left Sequence: cctttttggcgaatttttca. Outer Right Sequence: gacgctccgatattccgata. Inner Left Sequence: ttcaggttaaaatggccgac. Inner Right Sequence: ggtcttggcacgaatttgat. Inner Primer PCR Length: 2346. Estimated Deletion Size: about 1050 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49G7.1 Homozygous. Outer Left Sequence: cttatgggtttcaccacgct. Outer Right Sequence: cggctggaaaaagttaccaa. Inner Left Sequence: gcaaactcgaaagcagttcc. Inner Right Sequence: agtagcgggcaaaagactga. Inner Primer PCR Length: 2650. Deletion Size: 1045 bp. Deletion left flank: AAAAATGCAACGACCGACTTCAACGGCCACC. Deletion right flank: TTTGTACTGAACTTTCTTAACCAGGTACTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C41C4.5 Homozygous. Outer Left Sequence: gttatgacgaagagcgaggc. Outer Right Sequence: cgaagaccataattcgctcc. Inner Left Sequence: cgtttgagcacaccttcaaa. Inner Right Sequence: catctctccaactgcgaaca. Inner Primer PCR Length: 3052. Estimated Deletion Size: about 950 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32G9 Homozygous. Outer Left Sequence: ttcacctctttcaattgccc. Outer Right Sequence: gaaaatcgaaattcggcaaa. Inner Left Sequence: ctaagtggtgccactgacga. Inner Right Sequence: tatatcgacccgagccaaac. Inner Primer PCR Length: 2659. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04G11.4 Homozygous. Outer Left Sequence: aaccctccacttttgtcacg. Outer Right Sequence: gttaagggcagcaaccaaaa. Inner Left Sequence: tctggcagtgtgcaaatgat. Inner Right Sequence: ggggccttgagaccttatgt. Inner Primer PCR Length: 2137. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 779 bp. Sequence across the breakpoint: GGTATGTAGAACTTTTTTTTTGAA-breakpoint-AACAAAATGAGCAAAACTCGTGC . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58E10.5 Homozygous. Outer Left Sequence: cgggaatagcggtaatttga. Outer Right Sequence: gtgatgtgcgtggctgtaac. Inner Left Sequence: cactctcgcacgtgaaaaac. Inner Right Sequence: caatgcctgtcttttgagca. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06A10.4 Homozygous. Outer Left Sequence: ttctatgggcggagtttagc. Outer Right Sequence: aaaatgcaatttttccgtgc. Inner Left Sequence: gcgggaaatctttggttttt. Inner Right Sequence: ccgaattgtaagggcatgtt. Inner Primer PCR Length: 2193. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57H12.4 Homozygous. Outer Left Sequence: atttgccccctttgagactt. Outer Right Sequence: tgctttttccgaaattccat. Inner Left Sequence: tgccccctaagaacattgac. Inner Right Sequence: taacatgctgctggcatttc. Inner Primer PCR Length: 2957. Estimated Deletion Size: about 1300 bp. The breakpoint sequence from Neline Kriek is: atccatcaatgcatca - breakpoint - agcgcaatattcaag. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B7AL.2 Homozygous. Outer Left Sequence: tatgccgttatgccgttatg. Outer Right Sequence: aagactcgagagcggatgaa. Inner Left Sequence: cttttaaagcaatttcgccg. Inner Right Sequence: tcacatgtcaagggatcgag. Inner Primer PCR Length: 2173. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

3R5.1 Homozygous. Outer Left Sequence: gacagcgaaacaattgagca. Outer Right Sequence: attattaaacgcgcgaccag. Inner Left Sequence: cgaaggaggatcgttgaaaa. Inner Right Sequence: attgtggaagatcactcggc. Inner Primer PCR Length: 2475. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73E7A.4 Homozygous. Outer Left Sequence: ctcaatagagcgcgatttcc. Outer Right Sequence: gaggggcacggttaattttt. Inner Left Sequence: tcgccatagttttcgctttt. Inner Right Sequence: tttttgatgggtgggaatgt. Inner Primer PCR Length: 2695. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C11D2.2 Homozygous. Outer Left Sequence: aggccgattgcattgataag. Outer Right Sequence: ggggcaattttcaacaaaaa. Inner Left Sequence: ggtttgatcgacttgttggg. Inner Right Sequence: cccgatccgtttattcttga. Inner Primer PCR Length:3169. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08G5.5 Homozygous. Outer Left Sequence: attgggggattttccaagac. Outer Right Sequence: actagttttgggcatggtgc. Inner Left Sequence: ccgcgagcaaaatacctaaa. Inner Right Sequence: gctttaagcttcggctgttg. Inner Primer PCR Length: 2200. Estimated Deletion Size: about 750 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35D2.5 Homozygous. Outer Left Sequence: gacgaagagttcgtggaagg. Outer Right Sequence: tcatttcctttttctgcgct. Inner Left Sequence: aataacgggtctgttggcac. Inner Right Sequence: aagcattcattgctcggact. Inner Primer PCR Length: 3332. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK563.4 Homozygous. Outer Left Sequence: tctgcgtgttctggtggtta. Outer Right Sequence: tgggggatgtcttcttaacg. Inner Left Sequence: aaaagcattttgccctgttg. Inner Right Sequence: tttacccatcccatttttcg. Inner Primer PCR Length: 2129. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B1.3. Homozygous. Outer Left Sequence: TGCAATTGATCACTGGGAAA. Outer Right Sequence: TACCCCAGCTTAAGGCATTG. Inner Left Sequence: GCTTTTTGGCCAATTTTCAA. Inner Right Sequence: ACTGACACCGTTCCCTTGAC. Inner Primer PCR Length: 3169 bp. Deletion Size: 1278 bp. Deletion left flank: CACTATAGCGAAGTAGATAATGATGCGGGA. Deletion right flank: CTTTCACTAGTTCATTTATTGAAAACTGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43C3.1. Homozygous. Outer Left Sequence: TAATTGAATCGGGGCAAGTG. Outer Right Sequence: AGCCGGCACGAACTACTAAA. Inner Left Sequence: GATGGTCTGCATCTCCGATT. Inner Right Sequence: AGAAGCCGAACAACTTTGGA. Inner Primer PCR Length: 3216 bp. Deletion Size: 1135 bp. Deletion left flank: CAGTTCTGGACGACGAGGAATCTCTCACAG. Deletion right flank: ATGTACCTACTGAATATATTTCAACAATCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51F10.2. Homozygous. Outer Left Sequence: CTTCAGAGCCGTAGGTCAGG. Outer Right Sequence: ACGTTGCACCATGTTCAAAA. Inner Left Sequence: AAAACTGGCGGTATTGATGC. Inner Right Sequence: TTCTGATCCTCCCCCTTCTT. Inner Primer PCR Length: 2508 bp. Deletion Size: 1161 bp. Deletion left flank: CAATTTGCACAAAGTGCAACGCGATTTTCG. Deletion right flank: AATTTTGAGTATAAAATATAATTATCTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807