Search Strains

Y41E3.9 Homozygous. Outer Left Sequence: ttataaatccctgcgccaag. Outer Right Sequence: cgaatttagccagaaatcgc. Inner Left Sequence: gggtcaaagttccccatttt. Inner Right Sequence: caaaacacagaagcgagcaa. Inner Primer PCR Length: 3228. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M195.3 Homozygous. Outer Left Sequence: tctggcggctcttcttttta. Outer Right Sequence: tgcactcgggtaacattcag. Inner Left Sequence: cagccaaaccatgttcaatg. Inner Right Sequence: attatggcacaagggagacg. Inner Primer PCR Length: 3116. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105E8A.11 Homozygous. Outer Left Sequence: gcgtgacgacggtcttttat. Outer Right Sequence: tttcgagttcaaaattcggg. Inner Left Sequence: tagtcgttgttgttggcagc. Inner Right Sequence: acaacacatttaacgcgcaa. Inner Primer PCR Length: 2600. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02F3.5 Homozygous. Outer Left Sequence: ccgttgcgtaacagaaacaa. Outer Right Sequence: gccgtgtaggcaggtatcat. Inner Left Sequence: ggtttaactgggctgcagag. Inner Right Sequence: tcggttggtattgcagtgaa. Inner Primer PCR Length: 3050. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y42H9B.2. Homozygous. Outer Left Sequence: AATTCAACTGGCTGACTGGG. Outer Right Sequence: CTGAGCCATCTCGATCGTTT. Inner Left Sequence: CTCACTTCTCCCTTCCGTTG. Inner Right Sequence: CAAGTCAACGACTTTTCGCA. Inner Primer PCR Length: 2978 bp. Deletion Size: 1347 bp. Deletion left flank: GGATACGGTATCCAATAGCATCACTGTTCC. Deletion right flank: TCGAAGTTTGTAACCGATCACATCTCCATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08G2.7 Homozygous. Outer Left Sequence: gaaatccgagagctcagcag. Outer Right Sequence: agtcaaccacccctcttcct. Inner Left Sequence: actcgatttcctcatcacgg. Inner Right Sequence: tgaaataattccaggaccgc. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32A6.4a Homozygous. Outer Left Sequence: ctccggttttaaatttggca. Outer Right Sequence: acgttgggttttgagcattc. Inner Left Sequence: ttcgcgatgctcaatatcag. Inner Right Sequence: caaagacgttttgcgactca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43B11AR.3 Homozygous. Outer Left Sequence: ctgtgactggtgcagttgct. Outer Right Sequence: actggaggacgtaacgttgg. Inner Left Sequence: cgatgtgagttctgctggaa. Inner Right Sequence: aaagtccggctaaggttggt. Inner Primer PCR Length: 2110. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C8.14 Homozygous. Outer Left Sequence: taatatgagcaatgcgcgtc. Outer Right Sequence: ctacggtaggtggcggagta. Inner Left Sequence: gcgtacttcctcgtctaccg. Inner Right Sequence: gcggaatcaggtcaagtgtt. Inner Primer PCR Length: 3202. Estimated Deletion Size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C46A5.2 Homozygous. Outer Left Sequence: tgtctccgtctccttttgct. Outer Right Sequence: tggcggttctgatatcttcc. Inner Left Sequence: ggcagaagtacgacgagagg. Inner Right Sequence: tggtaaaggccgatacgaac. Inner Primer PCR Length: 2189. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06G8.2 Homozygous. Outer Left Sequence: acaccttcacgatgaccctc. Outer Right Sequence: acatttgtacggcctggaag. Inner Left Sequence: acatggggaggcataatcaa. Inner Right Sequence: gtcatggacgtcaagagggt. Inner Primer PCR Length: 2873. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22F7.5 Homozygous. Outer Left Sequence: gaaggaattcagggaaaggg. Outer Right Sequence: tactttttgggggtttgtcg. Inner Left Sequence: tcactggcgataacatccaa. Inner Right Sequence: tctgcgggaaaaatgatctc. Inner Primer PCR Length: 2746. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05E11.5 Homozygous. Outer Left Sequence: agccaaatttgaacacctgc. Outer Right Sequence: ttcgattccaaaagaggcat. Inner Left Sequence: agattgacgcccattacctg. Inner Right Sequence: cgaaaacctaaaagcatcgg. Inner Primer PCR Length: 2644. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.6 Homozygous. Outer Left Sequence: atgcggaataacggagtgtc. Outer Right Sequence: atcagtttgcagcttccgat. Inner Left Sequence: cgcgaattcacacacaaagt. Inner Right Sequence: tggcttctggagggatagtg. Inner Primer PCR Length: 2266. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20B5.3 Homozygous. Outer Left Sequence: caatgtcgtcaatggctacg. Outer Right Sequence: gttgttgaaggtaagcccca. Inner Left Sequence: taggaaatatccacgcgacc. Inner Right Sequence: cgaatttcaggcttctacgg. Inner Primer PCR Length: 3268. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04B4.2 Homozygous. Outer Left Sequence: tggcccttgtttaaatgctc. Outer Right Sequence: tcttaaccgttcggaaatcg. Inner Left Sequence: gtcgcgtcgcaacaatacta. Inner Right Sequence: ccaaggcaacaaaaggagaa. Inner Primer PCR Length: 2268. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05G6.8 Homozygous. Outer Left Sequence: gctgaaacatgccaaggatt. Outer Right Sequence: tcaaaatgtttctctggccc. Inner Left Sequence: ctatgcgaaagaaagggcag. Inner Right Sequence: tggcgttggtgacaataaaa. Inner Primer PCR Length: 2912. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02H5.7 Homozygous. Outer Left Sequence: gggatgggggatcagataat. Outer Right Sequence: aaatttgcatttgcctttgg. Inner Left Sequence: gttgctcactttatggggga. Inner Right Sequence: aatgccatgccatgtagtca. Inner Primer PCR Length: 2981. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y82E9BR.14 Homozygous. Outer Left Sequence: ggggttcaggagggtaaaaa. Outer Right Sequence: atttgaagaatttcgcgtgc. Inner Left Sequence: cacgttaagccggaaattgt. Inner Right Sequence: gcgtcacggctagatttttc. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16A11.4 Homozygous. Outer Left Sequence: ctaccaagaaaatcgccgaa. Outer Right Sequence: gtggaggcaccgtaacttgt. Inner Left Sequence: catagaaattccgccgaaaa. Inner Right Sequence: tctcgacgcgaaaaggttat. Inner Primer PCR Length: 2747. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24G7.4 Homozygous. Outer Left Sequence: ccctttttgacgtgcattct. Outer Right Sequence: ggagcccataaacaccaaaa. Inner Left Sequence: acaagcagtttgccaatcaa. Inner Right Sequence: ttgttttgaagcgaaaaccc. Inner Primer PCR Length: 3185. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19C6.1 Homozygous. Outer Left Sequence: AGGAATGAATCGGAGACGTG. Outer Right Sequence: TTGCCACAGCTTCGTAATTG. Inner Left Sequence: CAGGACAAAACGGAGGTGTT. Inner Right Sequence: AACAGTGGAACAAAGGACGG. Inner Primer PCR Length: 2808. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G11A.6 Homozygous. Outer Left Sequence: cggcgattcttatactccca. Outer Right Sequence: attccccgtataccctgacc. Inner Left Sequence: ggccaattttctgcctgata. Inner Right Sequence: gcctgtccaaaataagcgag. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40H3.5 Homozygous. Outer Left Sequence: ATGCACGTGTTCCTCCTTTC. Outer Right Sequence: ACCACCAAACGGTAATGGAA. Inner Left Sequence: TTAAAGCCGATGGGAATCTG. Inner Right Sequence: TAGAGACGAGCAGAGCGTGA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10B11.2 Homozygous. Outer Left Sequence: GGTTCGGCAAAGCACATAAT. Outer Right Sequence: TAACAACGGCATTGAATGGA. Inner Left Sequence: TCATTCCGACGGTACCATTT. Inner Right Sequence: TGAAGCTTGAAATGCAGTGG. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R01B10.1 Homozygous. Outer Left Sequence: attccgataacattggctgg. Outer Right Sequence: aatctgttgccgacaaaacc. Inner Left Sequence: attttctggccaatttcgtg. Inner Right Sequence: ccacaattccaatcccaatc. Inner Primer PCR Length: 2103. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41C4A.14 Homozygous. Outer Left Sequence: tcacgcaatcagtgagcttc. Outer Right Sequence: accgagcattttattcgacg. Inner Left Sequence: gtgcgatggcctacaaaact. Inner Right Sequence: ctcggggatcgaacattaaa. Inner Primer PCR Length: 3107. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34G6.5 Homozygous. Outer Left Sequence: ccgtatcacacactcatcgg. Outer Right Sequence: attgctaaaacccgcagaaa. Inner Left Sequence: agaaggacaactggctccaa. Inner Right Sequence: caacacagcaagcgagaaaa. Inner Primer PCR Length: 2678. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC455.10 Homozygous. Outer Left Sequence: GGATAATCGTTGCAGCTGGT. Outer Right Sequence: AACACAAGGCATTTTCGGTC. Inner Left Sequence: TCGAAGAAAAGACGAGCACC. Inner Right Sequence: CAGGAATCACAGCGTCGATA. Inner Primer PCR Length: 3198. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08H9.5 Homozygous. Outer Left Sequence: AGACCCACAAGTTTTGTCGC. Outer Right Sequence: GAATTCCCTGGTGAACGAGA. Inner Left Sequence: TGTTGTGGACGGAACGTAAA. Inner Right Sequence: ATCAGCGCATTCGATCTTCT. Inner Primer PCR Length: 2643. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56B3.9 Homozygous. Outer Left Sequence: taagagagcggacgcatttt. Outer Right Sequence: gttaacggaatttcggggtt. Inner Left Sequence: cgtggaggacgatctgaaat. Inner Right Sequence: attcgactgccagtgagctt. Inner Primer PCR Length: 2116. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R153.1a Homozygous. Outer Left Sequence: acagcaccggcaaatatagc. Outer Right Sequence: tcgacacgctaatcgaagtg. Inner Left Sequence: agcagaacgtgcattgactg. Inner Right Sequence: ttgagcttccagacgatgtg. Inner Primer PCR Length: 3136. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22H9.4 Homozygous. Outer Left Sequence: gtggctgaaaattcggaaaa. Outer Right Sequence: tactgatccgcgtaaaaccc. Inner Left Sequence: aaaatcaatcggtttcagcg. Inner Right Sequence: gcggagacgttagacatggt. Inner Primer PCR Length: 2135. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0416.1 Homozygous. Outer Left Sequence: gcttcaaaaatagggcctcc. Outer Right Sequence: tttatttggatcagcccagc. Inner Left Sequence: cgtcagcacgcttttaatca. Inner Right Sequence: aggtacaaattggcgacctg. Inner Primer PCR Length: 3349. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23F12.2 Homozygous. Outer Left Sequence: atcagcactatctcgcccat. Outer Right Sequence: acgcaaacattgcaaaaatg. Inner Left Sequence: aaaaacgaaaccacagccac. Inner Right Sequence: cagtaacctagtcacgcgca. Inner Primer PCR Length: 3203. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.2 Homozygous. Outer Left Sequence: GGGGAGCCAGAGGTTAAAAG. Outer Right Sequence: TTCTCTCTCACTTCTCCGGC. Inner Left Sequence: ATACGAGCAAGCTCCCTCAA. Inner Right Sequence: GAAGGGTGAAGACACGGAAA. Inner Primer PCR Length: 2572. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C56E6.2 Homozygous. Outer Left Sequence: ccctttactcttcatccgca. Outer Right Sequence: cgtcgttcaaaacaagagca. Inner Left Sequence: aagagggtgcaagaatcacg. Inner Right Sequence: atcgtcgatgataaggcagg. Inner Primer PCR Length: 2177. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22H2.5a Homozygous. Outer Left Sequence: aactagaagaaatgggcggg. Outer Right Sequence: catttttgtgcaagctcacg. Inner Left Sequence: ttaacaaggaaatgtgggcg. Inner Right Sequence: ccagaactttcctcctgctg. Inner Primer PCR Length: 2122. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02B12.6. Homozygous. Outer Left Sequence: TCCGGTTGAATACACGTTGA. Outer Right Sequence: CTTGCGCTGATGTATCCAGA. Inner Left Sequence: TAAACTGGTAATCCCCGTCG. Inner Right Sequence: AAACTTCGGCAGTTGGAAGA. Inner Primer PCR Length: 3083 bp. Deletion Size: 994 bp. Deletion left flank: ATTGAAATGACATTTTTGGCGAGCGCCGCG. Deletion right flank: GCAGGCCAATTGTTGTCGTATATGCTTATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09B9.4 Homozygous. Outer Left Sequence: tcgagtaaatgtgcatggga. Outer Right Sequence: tccctctctctctcgtctgc. Inner Left Sequence: tcatcgggggatatggtcta. Inner Right Sequence: cagtcgttcgtgtgctcatt. Inner Primer PCR Length: 2287. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F4.2 Homozygous. Outer Left Sequence: actgattttgaggtggtggc. Outer Right Sequence: taaaaccgggaatggagttg. Inner Left Sequence: gtctcgccacgacgaattat. Inner Right Sequence: aaatttcagttcgcattccg. Inner Primer PCR Length: 3272. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.2b Homozygous. Outer Left Sequence: aaaaatgggcgtgttcagtc. Outer Right Sequence: aaccgtcgaccaattctgac. Inner Left Sequence: ccgaaggatgcagaaacatt. Inner Right Sequence: gtgggcggagtcaactaaag. Inner Primer PCR Length: 3015. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0336.11 Homozygous. Outer Left Sequence: cttgcaaacagttcaacgga. Outer Right Sequence: gagatgacggcttcgaaaag. Inner Left Sequence: tgttgacgataactcctgcg. Inner Right Sequence: tcaggtaatcggatcttggc. Inner Primer PCR Length: 2704. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T18D3. Homozygous. Outer Left Sequence: TTCCCGATATCTCAAAACGC. Outer Right Sequence: TGAATTCCCAAAATTCTCGC. Inner Left Sequence: TGACAAACAAAATGGCCAAA. Inner Right Sequence: CTCAAAGCGGATTAACCCAA. Inner Primer PCR Length: 3055 bp. Deletion Size: 1026 bp. Deletion left flank: AGTCACACAGACAAAAATTGGCATTTACAC. Deletion right flank: AAATAAACAGTCAGAGACTATTTGCGGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807