Search Strains

More Fields
Strain Species Genotype Add
RB625 C. elegans EEED8.6(ok382) II. Show Description
EEED8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB626 C. elegans gcy-37(ok384) IV. Show Description
C54E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB630 C. elegans rpm-1(ok364) V. Show Description
C01B7.6 Homozygous. Outer Left Sequence: cgaatctcctccacggaata. Outer Right Sequence: atcgatttgatggtacggga. Inner Left Sequence: tggaatggattctggtggat. Inner Right Sequence: gagttgggctgtatggagga. Inner Length: 2972. Estimated Deletion Size: 2272. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB631 C. elegans srp-2(ok350) V. Show Description
C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB633 C. elegans ptp-3(ok244) II. Show Description
C09D8.1a. Homozygous. Outer Left Sequence: gcattttgtttgccctgttt. Outer Right Sequence: tgcaatcgttttggaaatca. Inner Left Sequence: cctcctcgtatcctcgttca. Inner Right Sequence: tctccctgtcctctatccga. Inner primer WT PCR product: 2578. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB634 C. elegans C43F9.6(ok356) IV. Show Description
C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB635 C. elegans F07G6.2(ok362) X. Show Description
F07G6.2. Homozygous. Outer Left Sequence: tgcgctgtttagaattgtgc. Outer Right Sequence: ctcattgggcaaagtctggt. Inner Left Sequence: tgcgcagtgttccaataaag. Inner Right Sequence: atccgaaccattgactgagg. Inner primer WT PCR product: 2748. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB637 C. elegans F22A3.1(ok165) X. Show Description
F22A3.1 Homozygous. Outer Left Sequence: CACATCCGATGGATATGCCATGC. Outer Right Sequence: AATGTCGATATATTTGATGTGTTGGC. Inner Left Sequence: CCCATCGAGTATAACCGTCG. Inner Right Sequence: CATTGCGATTCCCATGTAACC. Inner Primer PCR Product: 3203. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB638 C. elegans sel-5(ok363) III. Show Description
F35G12.3A. Homozygous. Outer Left Sequence: CACTGAGCAATTGCCTTTCA. Outer Right Sequence: ATCGCCGAAGGTAGGTTTTT. Inner Left Sequence: CAAACACATCATCCACCACC. Inner Right Sequence: TTTCTTCCAGGTGGATTTGC. Inner primer WT PCR product: 3269. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB639 C. elegans elp-1(ok347) V. Show Description
F38A6.2. Homozygous. Outer Left Sequence: CTTGTCTCGTCCCTGAAAGC. Outer Right Sequence: GCTCGCTTTCCTATTCAACG. Inner Left Sequence: TTGCCAATTCCAAACAGACA. Inner Right Sequence: ATTATATCCGACGTGCTGCC. Inner primer WT PCR product: 3036. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB640 C. elegans skr-3(ok365) V. Show Description
F44G3.6. Homozygous. Outer Left Sequence: tgtaccaccgtgaggaaaca. Outer Right Sequence: atgcacacattacccccatt. Inner Left Sequence: gcgactcattcagcatcaga. Inner Right Sequence: tggcataggtcctggcttag. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB641 C. elegans snf-2(ok147) I. Show Description
F55H12.1. Homozygous. Outer Left Sequence: CTCCCTACCACGCATTGTTT. Outer Right Sequence: CCACTCCGTCACCCACTACT. Inner Left Sequence: TTGAACGTGGACTTTTCGTG. Inner Right Sequence: TGATATTCGCTCGCAGTGAC. Inner primer WT PCR product: 3669. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB642 C. elegans F57F10.1(ok368) II. Show Description
F57F10.1. Homozygous. Anion exchange protein. Outer Left Sequence: attgtgattgcaccaagcag. Outer Right Sequence: aatcaatgagacgcggaatc. Inner Left Sequence: tggtgatggcacaaagtgtt. Inner Right Sequence: tcgatgaatggatacggtga. Inner primer WT PCR product: 2831. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB643 C. elegans msp-38(ok346) IV. Show Description
K08F4.8. Homozygous. Outer Left Sequence: atgctgggtgaaactaacgg. Outer Right Sequence: caaaagcatcgcagaaaaca. Inner Left Sequence: ctggaagttgtccagatggc. Inner Right Sequence: tccggtgtgaaatgtaacga. Inner primer WT PCR product: 2582. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB646 C. elegans mtd-1(ok353) I. Show Description
ZK337.5. Homozygous. Outer Left Sequence: ACTGAAATGGGTGCTGCTCT. Outer Right Sequence: CAAATGTTGAGTCTTGCCGA. Inner Left Sequence: TGATAGTTCCGCCAACAACA. Inner Right Sequence: ACGCAGCCTTCTCAACTGAT. Inner primer WT PCR product: 2985. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB647 C. elegans cdc-25.3(ok358) III. Show Description
ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB648 C. elegans snf-8(ok349) IV. Show Description
ZK829.10. Homozygous. Outer Left Sequence: CACGTGTAAGCTCGACTCCA. Outer Right Sequence: ACATTGAACAATGCGGAACA. Inner Left Sequence: GGCCCACTCTTTAATACGCA. Inner Right Sequence: GAACTTGCCCCCACATCTAA. Inner primer WT PCR product: 3546. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB651 C. elegans rhr-2(ok403) V. Show Description
B0240.1. Homozygous. Outer Left Sequence: CCCGTTTTACCAATCCCTTT. Outer Right Sequence: ATGACACACGACGGACAAAA. Inner Left Sequence: CGAAAGCGAGACTTTCCGTA. Inner Right Sequence: TAACTGCAAGAAAATCGGGG. Inner primer WT PCR product: 3086. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB652 C. elegans puf-7(ok361) IV. Show Description
B0273.2. Homozygous. Outer Left Sequence: cagattttgagccaagctcc. Outer Right Sequence: gtgaacttctcgaagacggc. Inner Left Sequence: aatcattttcccgtccgttt. Inner Right Sequence: tccagtggatagttggcct. Inner primer WT PCR product: 3185. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB653 C. elegans ogt-1(ok430) III. Show Description
K04G7.3. Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner primer WT PCR product: 2730. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB654 C. elegans sir-2.3(ok444) X. Show Description
F46G10.3. Homozygous. Outer Left Sequence: cgcaccatattgctttgatg. Outer Right Sequence: gcatatgctgctgctgctaa. Inner Left Sequence: actctctcgcctgtgtcaaat. Inner Right Sequence: cgaagcgcttatcacctttc. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB655 C. elegans T08D2.7(ok431) X. Show Description
T08D2.7. Homozygous. Outer Left Sequence: ataagacggcgttccacagt. Outer Right Sequence: acttggcgcgttagatgact. Inner Left Sequence: atgcaccgctcagctttatt. Inner Right Sequence: tcgatagagacctccggttg. Inner primer WT PCR product: 2905. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB656 C. elegans glh-1(ok439) I. Show Description
T21G5.3. Homozygous. Outer Left Sequence: agtgcatttggaggatcagg. Outer Right Sequence: aaagagtttgcgcgtcattt. Inner Left Sequence: cgatcgagtgactgtccaga. Inner Right Sequence: ttcaattgcagacttcgtcg. Inner primer WT PCR product: 2952. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB658 C. elegans glc-4(ok212) II. Show Description
C27H5.8. Homozygous. Outer Left Sequence: tcagcaccttcactgattgc. Outer Right Sequence: ttcccgaccactaggtatgc. Inner Left Sequence: cgacacattgtacagacccg. Inner Right Sequence: gcacctccaccacaggttat. Inner primer WT PCR product: 3279. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB659 C. elegans C54A12.4(ok400) II. Show Description
C54A12.4. Homozygous. Outer Left Sequence: tcatccttcggcataccttc. Outer Right Sequence: atttcccactggttgcactc. Inner Left Sequence: tccgtggtggttattggatt. Inner Right Sequence: gaaaccggtcacaagttcgt. Inner primer WT PCR product: 2628. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB660 C. elegans arr-1(ok401) X. Show Description
F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB661 C. elegans Y1A5A.1(ok414) III. Show Description
Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB662 C. elegans apb-3(ok429) I. Show Description
R11A5.1A. Homozygous. Outer Left Sequence: cgatatgccgaagaacaaca. Outer Right Sequence: caacagaaactcgtgctcca. Inner Left Sequence: tggaagtgctctccgagttt. Inner Right Sequence: tttcccttcacatcgagacc. Inner primer WT PCR product: 2880. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB663 C. elegans F13G3.4(ok417) I. Show Description
F13G3.4. Homozygous. Outer Left Sequence: TTTCGTATTTCCAACTCCCG. Outer Right Sequence: CAACTGGATCCCCATTTGAC. Inner Left Sequence: TGATCCAATCAGCGACTTTG. Inner Right Sequence: CGATTTATCTGCATGCCTCA. Inner primer WT PCR product: 2157. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB664 C. elegans F13G3.3&dylt-1(ok416) I. Show Description
F13G3.3, F13G3.4. Homozygous. Outer Left Sequence: TTTCGTATTTCCAACTCCCG. Outer Right Sequence: CAACTGGATCCCCATTTGAC. Inner Left Sequence: TGATCCAATCAGCGACTTTG. Inner Right Sequence: CGATTTATCTGCATGCCTCA. Inner primer WT PCR product: 2157. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB665 C. elegans dop-1(ok398) X. Show Description
F15A8.5. [NOTE (10/28/11): Possible heterozygous strain; genotype being confirmed by Moerman Lab] Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB666 C. elegans C46G7.2(ok399) III. Show Description
C46G7.2. Homozygous. Outer Left Sequence: tgaagtgccctgctatcaca. Outer Right Sequence: aatcaatgctctcgctcgtt. Inner Left Sequence: tccagttccctaggcacatc. Inner Right Sequence: gatgggtcttgcaacgattt. Inner primer WT PCR product: 2450. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB667 C. elegans far-2(ok435) III. Show Description
F02A9.3. Homozygous. Outer Left Sequence: AATGAGCAATTCAAATGGGC. Outer Right Sequence: CCCTTCTTCCTTCCATCTCC. Inner Left Sequence: CAGTTGCGAAGAATCAGCAG. Inner Right Sequence: TGTGACCCTTTGATAAGCCC. Inner primer WT PCR product: 2989. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB668 C. elegans ftn-2(ok404) I. Show Description
D1037.3. Homozygous. Ferritin. Outer Left Sequence: atctgcctgctttttgcact. Outer Right Sequence: agtttcgaatacgggtcgtg. Inner Left Sequence: gcaaacaaaaacgcttcgat. Inner Right Sequence: actggagctgcaatttgctt. Inner primer WT PCR product: 3129. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB669 C. elegans wee-1.1(ok418) II. Show Description
F35H8.7. Homozygous. Outer Left Sequence: CCCCTCTGAAATTCCAGTCA. Outer Right Sequence: GAGGCTCCACCCACTTACAA. Inner Left Sequence: TCCCAAAACCTTGAATCAGC. Inner Right Sequence: CCGTTGAGCTCACATGCTTA. Inner primer WT PCR product: 2343. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB67 C. elegans okIs63. Show Description
okIs63 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB670 C. elegans sst-20(ok427) I. Show Description
F54C1.9. Homozygous. Outer Left Sequence: catcaacagctgcgaaacat. Outer Right Sequence: atcatgacatcgtggctgaa. Inner Left Sequence: agtccgaatcgatccctctt. Inner Right Sequence: caccgcctctctttctcaac. Inner primer WT PCR product: 2883. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB671 C. elegans fmo-1(ok405) IV. Show Description
K08C7.2. Homozygous. Outer Left Sequence: GAACAAAGGATGTCGGAGGA. Outer Right Sequence: TCGCAGCATTTTCTTTTGTG. Inner Left Sequence: ACATCAAAGGAAATGACGGC. Inner Right Sequence: CCGATCACACCAGGAAAAAT. Inner primer WT PCR product: 2403. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB673 C. elegans Y1A5A.1(ok445) III. Show Description
Y1A5A.1. Homozygous. lim domain. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB674 C. elegans stam-1(ok406) I. Show Description
C34G6.7. Homozygous. Outer Left Sequence: gctcaagagtgtggaggagg. Outer Right Sequence: gctcggaaaaatcactgctc. Inner Left Sequence: gattaatgggagaatgccga. Inner Right Sequence: ctgttgagaattgggaggga. Inner primer WT PCR product: 2799. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB675 C. elegans pmp-4(ok396) IV. Show Description
T02D1.5. Homozygous. ABC transporter. Outer Left Sequence: aaacagcctgagacggaatg. Outer Right Sequence: tatgtattggtgcggcttga. Inner Left Sequence: atgccatgacacttgcttca. Inner Right Sequence: atgcaccacctgtgcaaata. Inner primer WT PCR product: 2613. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB676 C. elegans num-1(ok433) V. Show Description
T03D8.1b. Homozygous. Outer Left Sequence: CGTTAGGACCGTGTCGAAT. Outer Right Sequence: AGCGATTAAAAGAAACGCGA. Inner Left Sequence:CCGCAATGTTTTATGGGAAA. Inner Right Sequence: ACCGCATCCCAACATAAAAG. Inner primer WT PCR product: 2514. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB677 C. elegans mbk-1(ok402) X. Show Description
T04C10.1. Homozygous. Outer Left Sequence: cgggtaatcgagtttctcca. Outer Right Sequence: actaatgcagaagcggcact. Inner Left Sequence: gaaacgtgtcatccagctca. Inner Right Sequence: tggaatgattggtatcccgt. Inner primer WT PCR product: 2563. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB68 C. elegans okIs64. Show Description
okIs64 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RB680 C. elegans ZK770.1(ok415) I. Show Description
ZK770.1. Homozygous. Outer Left Sequence: AAATTTCAGGCCACCAAATG. Outer Right Sequence: GACGAAGGCGGATAGGTGTA. Inner Left Sequence: ACGTTTCAACTGGATGGAGG. Inner Right Sequence: TGCATGAACTGTTAACCGGA. Inner primer WT PCR product: 2874. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB681 C. elegans cat-1(ok411) X. Show Description
W01C8.6. Homozygous. Outer Left Sequence: CCATTGAATGTGCAACGAAC. Outer Right Sequence: ATGGATTAGCAGTCCATCGC. Inner Left Sequence: TCGAGTGACCTCAAACATGC. Inner Right Sequence: ATGCAAGCATACTGGGAAGG. Inner primer WT PCR product: 2850. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB682 C. elegans moc-1(ok366) X. Show Description
T06H11.4. Received new stock 9/15/04. Homozygous. [NOTE: Seems to grow better at lower temperature (15C).] Outer Left Sequence: GGTCTGTTGCATGTGGTTTG. Outer Right Sequence: TTCGTCATCCCTCTTCATCC. Inner Left Sequence: TCTAAGCTGCAAACTCGCAA. Inner Right Sequence: AATCTGTTACCCTTGCTGCG. Inner primer WT PCR product: 3273. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB683 C. elegans inx-20(ok426) I. Show Description
T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2908. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB684 C. elegans tank-1(ok446) V. Show Description
ZK1005.1. Homozygous. Outer Left Sequence: AATGAGATTGGCGGAATGAG. Outer Right Sequence: TCCAACATCCACAGGACAAA. Inner Left Sequence: TTCCAAGCTGTTCCCATTTC. Inner Right Sequence: TTACTCTCGCGGATTCGTCT. Inner primer WT PCR product: 2752. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB685 C. elegans cdh-7(ok428) II. Show Description
R05H10.6. Homozygous. Outer Left Sequence: CCACCAAAGTGCACATCAAC. Outer Right Sequence: TGTCTTGCCTCATGTCTTGC. Inner Left Sequence: AGTTGACGATGGAGAATGGC. Inner Right Sequence: GTTCCATCCACGGTGTCTCT. Inner primer WT PCR product: 2740. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807