Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB647 C. elegans cdc-25.3(ok358) III. Show Description
ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2572 C. elegans Y38F1A.6(ok3580) II. Show Description
Y38F1A.6 Homozygous. Outer Left Sequence: gtttgcgtgtcgcgtagtaa. Outer Right Sequence: tgttggtggaggatctgtga. Inner Left Sequence: aagccggcaatatttaaacg. Inner Right Sequence: tcgacacgacgaaggctg. Inner Primer PCR Length: 1331. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2573 C. elegans ZK6.7(ok3581) V. Show Description
ZK6.7 Homozygous. Outer Left Sequence: ccaaatggcaagagacctgt. Outer Right Sequence: ctcaaggtgtgaaggtgcaa. Inner Left Sequence: cttcatgcaacacggcct. Inner Right Sequence: agcttgatagccggacgata. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2574 C. elegans C09G5.8(ok3582) II. Show Description
C09G5.8 Homozygous. Outer Left Sequence: ttgtttgcaacttccgtgag. Outer Right Sequence: agggtttgcggcttctattt. Inner Left Sequence: tataaccagggatttcggca. Inner Right Sequence: tttgtgtcaaaacatgaaaagc. Inner Primer PCR Length: 1282. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2575 C. elegans flp-17(ok3587) IV. Show Description
C52D10.11 Homozygous. Outer Left Sequence: ggaaaattcacgaactggga. Outer Right Sequence: gtgccgactgaaagaagagc. Inner Left Sequence: cagggggttgtgaatttttg. Inner Right Sequence: ttttgcaagatggtgagtcg. Inner Primer PCR Length: 1301. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2576 C. elegans K02E11.7(ok3588) V. Show Description
K02E11.7 Homozygous. Outer Left Sequence: atcgggacccacaaactaca. Outer Right Sequence: gcaaacttttcggtgcaaac. Inner Left Sequence: gcttggtgatcaattgtttgg. Inner Right Sequence: tgttgagtcagtcggaatctg. Inner Primer PCR Length: 1209. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2577 C. elegans nft-1(ok3589) III. Show Description
Y56A3A.13 Homozygous. Outer Left Sequence: cgacttgagctacgtggaca. Outer Right Sequence: catcgcatctcttgtagcca. Inner Left Sequence: tcttcgtgaaatgcaaccag. Inner Right Sequence: tgcgaaattttgggattttg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2896 C. elegans F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I. Show Description
F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807