| RB647 |
C. elegans |
cdc-25.3(ok358) III. Show Description
ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|