C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53B3.5 Homozygous. Outer Left Sequence: gtcgacatgatgacacaggg. Outer Right Sequence: cttcagcaaaatgggctctc. Inner Left Sequence: ggatggcatgcctacgtaat. Inner Right Sequence: gtgcatctggagcaacgagt. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G10.8 Homozygous. Outer Left Sequence: attctgaatgtccggtttgg. Outer Right Sequence: attggtgggtctcgattgaa. Inner Left Sequence: atccagcatttgatgtcacg. Inner Right Sequence: catagctttgagctgaataagtatgtt. Inner Primer PCR Length: 1334. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10B4.4 Homozygous. Outer Left Sequence: cggcttctgttgaggaagag. Outer Right Sequence: attcagtttggcggtttcag. Inner Left Sequence: tgtcaaacacgcttcgaact. Inner Right Sequence: cgcaaaatgttttagggctc. Inner Primer PCR Length: 1149. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4A.2 Homozygous. Outer Left Sequence: cccgccaaaaattattcaga. Outer Right Sequence: accgtaatgggacagacagc. Inner Left Sequence: atttccggccaaaaattgat. Inner Right Sequence: tcagaattcagtgttaccgca. Inner Primer PCR Length: 1229. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17G10.5 Homozygous. Outer Left Sequence: ctccacgagttccaccaaat. Outer Right Sequence: tcaaaatggaaaagggaacg. Inner Left Sequence: cagcttcagtgcctcaaaca. Inner Right Sequence: aaattagagccaagctcgca. Inner Primer PCR Length: 1326. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30F12.2 Homozygous. Outer Left Sequence: cgagaactgaatcgtgggat. Outer Right Sequence: ccccaattcgctcaaaatta. Inner Left Sequence: tcattagctgcagattgtttgaa. Inner Right Sequence: tctgcaagttcaacggttttt. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK455.8 Homozygous. Outer Left Sequence: tttccgcagagcttggttac. Outer Right Sequence: tccctaccttcctggtgatg. Inner Left Sequence: ttgggatcaagttctcaactca. Inner Right Sequence: gacaatgcaataaccattccg. Inner Primer PCR Length: 1219. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.3 Homozygous. Outer Left Sequence: tgtttttgtgcttttcggtg. Outer Right Sequence: gttcagctcgattgtgggat. Inner Left Sequence: tgggccccaactataacatt. Inner Right Sequence: ccgaaattggcatcttgttc. Inner Primer PCR Length: 1219. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y22D7AL.5. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAATTGATTTTTCCCGCTGA. External right primer: AGGGGAAAAAGAGCCGTAAA. Internal left primer: GAAATTTTGGTTTTCCTGCG. Internal right primer: CAAATGGCTCAGAGCACAAA. Internal WT amplicon: 1227 bp. Deletion size: 611 bp. Deletion left flank: AAAAATTTGAATTTTTCGTGAAAATTTGAA. Deletion right flank: GCTCTCAATCTCTCATTGAAATAACGACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807