| RB810 |
C. elegans |
R07E5.3(ok622) III. Show Description
R07E5.3, R07E5.14. Homozygous. Outer Left Sequence: ATTATTGTGATACCGGGCCA. Outer Right Sequence: AATTGAGAAGAGCGAGCGAG. Inner Left Sequence: CTACGCGAAACGGATCAAAT. Inner Right Sequence: CGTGGATTGGAGAGGACAAT. Inner primer WT PCR product: 2877. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB811 |
C. elegans |
glo-4(ok623) V. Show Description
F07C3.4. Homozygous. Outer Left Sequence: ATTCTGGTGGAGAACCAACG. Outer Right Sequence: AACAACTGCTTCCCGAGGTA. Inner Left Sequence: AGGAACATGACGAAAGGCAG. Inner Right Sequence: TGATTCCATCTGGCTCCTTC. Inner primer WT PCR product: 2769. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB812 |
C. elegans |
fax-1(ok624) X. Show Description
F56E3.4. Homozygous. Outer Left Sequence: TAGTGCACGGACTAGGGCTT. Outer Right Sequence: AGATTGAGCACCACCAAACC. Inner Left Sequence: GGAAGCCCTAGCGAGAAGAT. Inner Right Sequence: CTTGAAGTGGCACGAGTCAA. Inner primer WT PCR product: 2430. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB813 |
C. elegans |
C41C4.1(ok625) II. Show Description
C41C4.1. Homozygous. Outer Left Sequence: CACCAGAAATTGAGCAAGCA. Outer Right Sequence: CCCTCGTCCATTTGCTACAT. Inner Left Sequence: TTGCATTTCGATTGGCATAA. Inner Right Sequence: CCCTGGTGATAACACGGTTT. Inner primer WT PCR product: 2704. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB814 |
C. elegans |
cdk-5(ok626) III. Show Description
T27E9.3, T27E9.4. Homozygous. Outer Left Sequence: GAAACTCAACTTCTTCGCCG. Outer Right Sequence: TCCGGTATACGCAAATGACA. Inner Left Sequence: ATGTCCGCTATGTTCAAGGG. Inner Right Sequence: TCATGTTGGCTTCCATCAAA. Inner primer WT PCR product: 2658. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB815 |
C. elegans |
F18F11.3(ok628) IV. Show Description
F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB816 |
C. elegans |
sra-11(ok630) II. Show Description
F44F4.13. Homozygous. Outer Left Sequence: ATGTGGACAATAAGGGCAGC. Outer Right Sequence: CAGCTCATCCTGCTCAAATG. Inner Left Sequence: CAATTTCGCACGGAATCTTT. Inner Right Sequence: GCGATTGTAGATGTCTGGCA. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB817 |
C. elegans |
abt-4(ok633) V. Show Description
Y39D8C.1. Homozygous. Outer Left Sequence: ATGGACAGCGTGTCATACCA. Outer Right Sequence: TTTGGGTAAGTTGGGCTTTG. Inner Left Sequence: CGGCTCCGTCACTTCTATTC. Inner Right Sequence: GATCTCAAGAACCCCGACAA. Inner primer WT PCR product: 3226. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB818 |
C. elegans |
hum-1(ok634) I. Show Description
F29D10.4. Homozygous. Outer Left Sequence: AGTGCATGCAAACAGCACTC. Outer Right Sequence: CAGTAAATACGCCGGTGGTT. Inner Left Sequence: CCAACCAGGGACTGAAGTGT. Inner Right Sequence: GTCAATGTTCAGCATGTCGG. Inner primer WT PCR product: 3054. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB819 |
C. elegans |
xbx-4(ok635) IV. Show Description
C23H5.3. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2596. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB820 |
C. elegans |
bmk-1(ok391) V. Show Description
F23B12.8 Homozygous. Outer Left Sequence: CGAGAACCTGCTTTTCAAGG. Outer Right Sequence: CAATCTTGTGCTACTGCCGA. Inner Left Sequence: ATTTGCTGCGAACCTTGACT. Inner Right Sequence: GCCGCGAATCATTGTATTTC. Inner Primer PCR Length: 2690. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB821 |
C. elegans |
clh-2(ok636) II. Show Description
B0491.8 Outer Left Sequence: AACAAATCTTCCCGTGCATC. Outer Right Sequence: ATCGATAGACCATTGGCTGG. Inner Left Sequence: GCTCAACTTCAGGGCAGACT. Inner Right Sequence: GTAGATATTGGCCATCGCGT. Inner Primer PCR Length: 2884. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB822 |
C. elegans |
dhs-6(ok637) II. Show Description
C17G10.8. Homozygous. Outer Left Sequence: CCATAGAGCGTTCACAGCAA. Outer Right Sequence: CTAACGTGTGGCTTTGGGAT. Inner Left Sequence: TATGTGCACCTTTACGGGGT. Inner Right Sequence: ACGCAATGCTGATGAAGTTG. Inner Primer WT PCR product: 3096. Deletion size: 924 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB823 |
C. elegans |
ceh-37(ok642) X. Show Description
C37E2.5. Homozygous. Outer Left Sequence: CACCCAACGGAACTCTTGT. Outer Right Sequence: GGTACACGAGCATGGGTCT. Inner Left Sequence: CGGAAATCGCAATGTAATC. Inner Right Sequence: TAAATTCGACTCGGGCTTT. Inner primer WT PCR product: 2900. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB824 |
C. elegans |
F52F12.6(ok646) I. Show Description
F52F12.6. Homozygous. Outer Left Sequence: ACGGATGGAACAGGTGACTC. Outer Right Sequence: TCATGATGGATTGGCTGAAA. Inner Left Sequence: TTGGGAAATTTGGAAACTGG. Inner Right Sequence: TATGAAACAAATGCTGGCGA. Inner primer WT PCR product: 3150. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB825 |
C. elegans |
hsp-43(ok647) X. Show Description
C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB826 |
C. elegans |
F56D6.11&F56D6.21(ok650) IV. Show Description
F56D6.11&F56D6.21. Homozygous. Outer Left Sequence: TACGGGCCTCTGTCAATTTC. Outer Right Sequence: TCGTCGTGATTGTGTTGGTT. Inner Left Sequence: GCTCTCTTCCAAATGGCAAC. Inner Right Sequence: ATTCGGTGGCAAAAGTCAAG. Inner primer WT PCR product: 3169. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB827 |
C. elegans |
C23H5.8(ok651) IV. Show Description
C23H5.3, C23H5.8. Homozygous. Outer Left Sequence: TCAAACAAATTGCGAAGCAG. Outer Right Sequence: TGGGGTGCTGAAAATTTAGG. Inner Left Sequence: ATTCTGGGAGCCCAAGTTTT. Inner Right Sequence: GTGATGCTTCTCGGTCCAAT. Inner primer WT PCR product: 2595. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB828 |
C. elegans |
srd-2(ok652) II. Show Description
R05H5.1. Homozygous. Outer Left Sequence: AGCTCTCGTCATCGAGCATT. Outer Right Sequence: TTCGACATGCTCTCCAACAG. Inner Left Sequence: TTTGAATTTCTCACGGAACG. Inner Right Sequence: AGACGAACCCAAAATGATCG. Inner primer WT PCR product: 3326. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB829 |
C. elegans |
B0336.6(ok640) III. Show Description
B0336.6. Homozygous. Outer Left Sequence: GATACAATTCCCACGCCTTG. Outer Right Sequence: GGAAGGCGGAATGAGTGTTA. Inner Left Sequence: GCAGTGAGAGAACGAGCACA. Inner Right Sequence: CGAGTCATGCGAATCTTCAA. Inner primer WT PCR product: 2654. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB830 |
C. elegans |
epac-1(ok655) III. Show Description
T20G5.5. Homozygous. Outer Left Sequence: TGGCCACAGCTCTTTTCTTT. Outer Right Sequence: GGGAAAACTCACGGTTTTGA. Inner Left Sequence: GTGGAGGAAGACCGTGTTGT. Inner Right Sequence: TGCCACTGATGAAAGGAGTG. Inner Primer WT PCR product: 3313. Deletion size: 999 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB831 |
C. elegans |
tbx-8(ok656) III. Show Description
T07C4.2 Homozygous. Outer Left Sequence: CAGTTTTTGCCCGTTTTGAT. Outer Right Sequence: AGAAATTGCGTGGCCTAGAA. Inner Left Sequence: AAAATGTTCCCGAAGCTTGA. Inner Right Sequence: TCTTGGTGGCAGAAAGAACC. Inner Primer PCR Length: 2408. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB832 |
C. elegans |
F27E11.1(ok657) V. Show Description
F27E11.1. Homozygous. Outer Left Sequence: AAGGGATGCAGATGATGGAG. Outer Right Sequence: TGCAGGCCTTCAGAACTTTT. Inner Left Sequence: AACCGGGAAGGAGTTACGAT. Inner Right Sequence: TCATGGACTGTGGCAGTAGC. Inner primer WT PCR product: 2891. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB833 |
C. elegans |
T27D12.2(ok658) II. Show Description
T27D12.2. Homozygous. Outer Left Sequence: ATAAGGGCAATGAGCACAGG. Outer Right Sequence: TGAGCTCACGCCAGAATATG. Inner Left Sequence: CTCCAACCACGGCATAAAGT. Inner Right Sequence: TCTACGGCTTATAGCTCGGC. Inner primer WT PCR product: 3227. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB834 |
C. elegans |
amx-1(ok659) III. Show Description
R13G10.2. Homozygous. Outer Left Sequence: TCCCGAGTATTTCGGCTATG. Outer Right Sequence: TACGTAGCATCACCATCCGA. Inner Left Sequence: TGACAACCGATGCTTCTCTG. Inner Right Sequence: ATACCGACGAATCGATCAGC. Inner primer WT PCR product: 3023. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB835 |
C. elegans |
rcq-5(ok660) III. Show Description
E03A3.2. Homozygous. Outer Left Sequence: CACACGTTTTCGCATTTCAC. Outer Right Sequence: GGAGCGTACTTGCCACATTT. Inner Left Sequence: GCCAACTCTCCAGAAACCAA. Inner Right Sequence: TTTCAGAGATGAGCTCGGGT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB836 |
C. elegans |
F57C7.2(ok661) X. Show Description
F57C7.2. Homozygous. Outer Left Sequence: ATCGCATGGACACCATCATA. Outer Right Sequence: TTGACTGGAAATGGAGGAGG. Inner Left Sequence: GGGCTTTCAAACATTACCGA. Inner Right Sequence: CGGTGTACAGCTTACTCGCA. Inner primer WT PCR product: 3059. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB837 |
C. elegans |
T07D3.4(ok664) II. Show Description
T07D3.4. Homozygous. Outer Left Sequence: ATGTCTAGGCGGTGGAGAGA. Outer Right Sequence: TGGGTGTTTGTGGTTGAAGA. Inner Left Sequence: GCAGTGTCGGCTGCTAATTT. Inner Right Sequence: TTTCTGAAACCCGTAGGACG. Inner primer WT PCR product: 2309. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB838 |
C. elegans |
T13H5.2(ok665) II. Show Description
T13H5.2. Homozygous. Outer Left Sequence: AGCTGGAAGAGGTTTGTGGA. Outer Right Sequence: CAACTTCAGGCTCCAGCTTC. Inner Left Sequence: TTTAGGTCCAGTGCTCGGTC. Inner Right Sequence: CCGAATTCGTTGATTCTGGT. Inner primer WT PCR product: 3051. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB839 |
C. elegans |
F54A3.4(ok666) II. Show Description
F54A3.4. Homozygous. Outer Left Sequence: ATAGAAAATGCGAGAGCGGA. Outer Right Sequence: GCCTGCCTACCATTAAAGCA. Inner Left Sequence: TGTGCAGGGTGTCTCATTGT. Inner Right Sequence: TTGAAATTTCTCGGGGTACG. Inner primer WT PCR product: 2859. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB840 |
C. elegans |
nhr-40(ok667) X. Show Description
T03G6.2 Homozygous. Outer Left Sequence: ATCAGTGTCCCCACCCATAA. Outer Right Sequence: GGCTTCCGTGTCTGAATGAT. Inner Left Sequence: TTCCATCTTTCTTCGTTCCG. Inner Right Sequence: TCGTCGACTTCTTTCCGTTT. Inner Primer PCR Length: 2895. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB841 |
C. elegans |
F14B8.1(ok668) X. Show Description
F14B8.1. Homozygous. Outer Left Sequence: TTCCATTGCTTCCCTCAATC. Outer Right Sequence: ATGGCAAGGGTGGTAGTGAC. Inner Left Sequence: ATTCCCAACATTTTCCACCA. Inner Right Sequence: TTGGCTGGGATGATTCTTTC. Inner primer WT PCR product: 2944. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB842 |
C. elegans |
abt-2(ok669) I. Show Description
F12B6.1. Homozygous. Outer Left Sequence: TGTCCTGGCCTAATTTTTGC. Outer Right Sequence: AAATGCCACGTATAATGCCC. Inner Left Sequence: GGCTCCACAGCAAATGAGAT. Inner Right Sequence: ACTGGAAATGGAACGAGACG. Inner Primer WT PCR Product: 2966. Deletion size: 1152 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB843 |
C. elegans |
wrt-5(ok670) IV. Show Description
W03D2.5, W03D2.3. Homozygous. Outer Left Sequence: GCGGTTTTTAATGGGGAAAT. Outer Right Sequence: TGAGAAGGAAGGATGATGGG. Inner Left Sequence: AACTGAGGCCTGGAGTTTGA. Inner Right Sequence: CAGCCTTTTTGGAGAGCTTG. Inner primer WT PCR product: 2763. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB844 |
C. elegans |
C06C6.5(ok671) V. Show Description
C06C6.5. Homozygous. Outer Left Sequence: TGAGGACACTCTCGCGTATG. Outer Right Sequence: CGCACACCTAACCATGACAC. Inner Left Sequence: AAATGTGAAATCTTTGCCGC. Inner Right Sequence: GTGCACCCGAGATCAAAAAG. Inner primer WT PCR product: 2464. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB845 |
C. elegans |
gur-4(ok672) II. Show Description
K09E4.5. Homozygous. Outer Left Sequence: TCGCGCAGTTATTTGAGTTG. Outer Right Sequence: TTCAATAATTCGGCTTTCGG. Inner Left Sequence: CGCCGAAACTTCTGAAAGTC. Inner Right Sequence: GTGTCTGAAATGGAGGGGAA. Inner primer WT PCR product: 3218. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB846 |
C. elegans |
F01D5.9(ok673) II. Show Description
F01D5.9. Homozygous. Outer Left Sequence: ATCATCAGTTTTCTTGGCGG. Outer Right Sequence: TTTTGCAGTGAGCGAAAATG. Inner Left Sequence: CTCTCCATTTCTCACCGCTC. Inner Right Sequence: TTCATGCGGAAATTGTTGAA. Inner primer WT PCR product: 2808. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB847 |
C. elegans |
C14H10.3(ok674) X. Show Description
C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB848 |
C. elegans |
rgef-1(ok675) V. Show Description
F25B3.3. Homozygous. Outer Left Sequence: TGTCGGCTTCTCTGTTGTTG. Outer Right Sequence: CGAGCGGTATCATTTTGGAT. Inner Left Sequence: CATACTGCCACGTGGTGAAG. Inner Right Sequence: GGAATTGCGAGCTATGGTGT. Inner primer WT PCR product: 2838. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB849 |
C. elegans |
kap-1(ok676) II. Show Description
F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB850 |
C. elegans |
egl-47(ok677) V. Show Description
C50H2.2. Homozygous. Outer Left Sequence: GATATGCTCATGTGGCATCG. Outer Right Sequence: AGATCGATGAGTGTGGAGGG. Inner Left Sequence: ATGCCATCTTTTTCAAACGG. Inner Right Sequence: GGAAGACCTGATTGGGTTGA. Inner Primer WT PCR Product: 2549. Deletion size: 966 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB851 |
C. elegans |
inx-20(ok681) I. Show Description
T23H4.1. Homozygous. Outer Left Sequence: GCAATCATGACAAAACGGTG. Outer Right Sequence: GGTCCCAACGGACACATTAC. Inner Left Sequence: GCCAACCTTGATTCCTCAAA. Inner Right Sequence: CCTGCTCAAACCACCTCATT. Inner primer WT PCR product: 2909. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB852 |
C. elegans |
ras-2(ok682) III. Show Description
F17C8.4. Homozygous. Outer Left Sequence: CTTCTCACATCAAACGGCAA. Outer Right Sequence: ACACCACTCATGCAAAGCTG. Inner Left Sequence: CCATGGATGCCTGAAAAGTT. Inner Right Sequence: CAGAAACGTTCGCAATTCAA. Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB853 |
C. elegans |
T14G12.4(ok683) X. Show Description
T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB854 |
C. elegans |
lrg-1(ok684) III. Show Description
F55H2.4. Homozygous. Outer Left Sequence: TGATCCAATGAAAGGCAACA. Outer Right Sequence: TCTTGCAAAATGATCCCCTC. Inner Left Sequence: GCGGATATTTTTGGGAGTGA. Inner Right Sequence: CTGCTCTCGGATTTCGTAGG. Inner primer WT PCR product: 2912. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB855 |
C. elegans |
Y32F6B.3(ok685) V. Show Description
Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB856 |
C. elegans |
B0393.5(ok686) III. Show Description
B0393.5. Homozygous. Outer Left Sequence:GTTCACCTGGATGGATTGGT. Outer Right Sequence:GCGAGTTCAAATTTTCGAGG . Inner Left Sequence: AAATTCAAAGGCAGCACCAC. Inner Right Sequence: TTCCGCAAAATCCAAAAATC. Inner primer WT PCR product: 3110. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB857 |
C. elegans |
pah-1(ok687) II. Show Description
K08F8.4. Homozygous. Outer Left Sequence:TCCAACGACGGTGAACACTA. Outer Right Sequence: CTCGTCACAAGGCAGTCGTA. Inner Left Sequence: CGTCTGTAAATCGAGCAGCA. Inner Right Sequence: GAAGTACGCCATGGAATCGT. Inner primer WT PCR product: 2344. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB858 |
C. elegans |
R09B3.3(ok688) I. Show Description
R09B3.3. Homozygous. Outer Left Sequence: CGTTGTTGATTTGTCCGATG. Outer Right Sequence: TGGTCTCCGCTCGTTCTACT. Inner Left Sequence: TGACGGTTTAATTTTTCCGC. Inner Right Sequence: CAGGATCTCAAGTGCCTCGT. Breaks are at R09B3 coordinates 4090/5259. Inner primer WT PCR product: 2206. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RB859 |
C. elegans |
Y57A10C.6(ok693) II. Show Description
Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|