| VF3 |
C. elegans |
hmt-1(gk161) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 2,149 bp deletion encompasses exons 5, 6 & 7; introduces premature stop codon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF8 |
C. elegans |
hmt-1(gk155) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 416 bp deletion encompasses exon 1; in-frame Met present in second exon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VH7000 |
C. elegans |
F21D5.6(hd7000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Deletion of 964 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAAGCAGATTTTTTTCCAAAAAATGAGCT; Right flanking sequence: CGGATTCTGGTAATTTTGCAGGTTTAGTTT. sgRNA #1: GATTGATTTGGTTCCCTTCG; sgRNA #2: TTTTCTCGAATAACTCTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7001 |
C. elegans |
gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7018 |
C. elegans |
col-144(hd7006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7019 |
C. elegans |
W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGTTTACAAAGTTTTAGCGGCCGACACCT; Right flanking sequence: AGGAATGATTCAAGATATATATATATATAG. sgRNA #1: TCTTATCTTAGAAACCCGCG; sgRNA #2: CTGTGTGTGAATACCAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7020 |
C. elegans |
gst-28(hd7007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTACTGAGTATCTGGACGAGCCTCTACCCA; Right flanking sequence: CGGAAGTCCTCGAATGGAACATCTGCCAAG. sgRNA #1: CAATTCCAGCTATCAGGAAG; sgRNA #2: TTCCATCTCCGTGTGTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7022 |
C. elegans |
ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7025 |
C. elegans |
F28H1.4(hd7025[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3045 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGTTGGGTGAAAAAGATCTTGCGAATTA; Right flanking sequence: AGGGAACTGTTCGAGAAAAAATGGGACAAG. sgRNA #1: GAGGGTGATACGTACATGTA; sgRNA #2: AAGAAAATGGGGAAACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7026 |
C. elegans |
lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7028 |
C. elegans |
F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7030 |
C. elegans |
F43C1.7(hd7013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7031 |
C. elegans |
dlat-1(hd7031[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1998 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGCATCGTGTGTGGCTTCTCGAGGAACTC; Right flanking sequence: TTTATCACACCGATTTTTTTTTATTTTCGC. sgRNA #1: CTTGAAGTGACGAAGCCAGA; sgRNA #2: CAAGGCGCGCGTGTTTAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7032 |
C. elegans |
npp-1(hd7032[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 3583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGGAGGGTGCCAGCAAACGCGCCCCT; Right flanking sequence: TGGCAGAAAATTGTTTTTAAAACTTATACA. sgRNA #1: CGAATTTTGTCTGTGTACGA; sgRNA #2: CTGTTTCGACCTAAGATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7033 |
C. elegans |
F36G9.3(hd7033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2120 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTTTGGGTTTCAAAATGAAGTATTTACCA; Right flanking sequence: TTTCAATATTCTCAATTCTGGCACTCATAT. sgRNA #1: TAAAACTAGACGGACGAGTC; sgRNA #2: GGATTGTGAGCACCCAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7034 |
C. elegans |
F17C8.6(hd7034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAAGATTTTGCATTGATTTTTAGATAGT; Right flanking sequence: TGCAACCATTTTAAGATTGTTTATTTGAAA. sgRNA #1: AAAGTACACGTATGCCACCT; sgRNA #2: CCATACCATCAGGAGGCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7035 |
C. elegans |
col-176(hd7035[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1915 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGTACTTCCTTCTTCTCATGACCTCCG; Right flanking sequence: CCGGGCGGCTATCCGCCAGGCCCAAACGGC. sgRNA #1: AAAACATAGGTGGTCGGGCA; sgRNA #2: ACACAACGGCCGTCTACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7036 |
C. elegans |
ZC373.5(hd7036[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1827 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGTTTCGAAGTAATCTCAATAAAATCCG; Right flanking sequence: TGGCAAGCACTCTTGTTGTGTTGGTCTCTT. sgRNA #1: GTTCGAAGACCATTCATGCT; sgRNA #2: TTCTCTAATCTCTCCGTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7037 |
C. elegans |
arrd-15(hd7037[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 7272 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTCAAAGCATATTCCACGTACTTTAGT; Right flanking sequence: TGGCAAACCTTCAAAACTGCTCTTTTCGGT. sgRNA #1: TCTCAAATACTTCGCGTGCT; sgRNA #2: TGCTAATGAGGTCATCGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7038 |
C. elegans |
T07E3.3(hd7038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGCCAAACTTCAAAATGGCTCCATTGCCA; Right flanking sequence: CATCAGTTTAGTCTTTTTTTTTCCCAAATC. sgRNA #1: TCGAAATAACATTTCACACG; sgRNA #2: CGAGTAAAGTGCAATAAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7039 |
C. elegans |
trcs-1(hd7039[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2438 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTATAAATCAAATTAACGGAGATCGTA; Right flanking sequence: GGGAGATCAAAACGTGTTTAGAATCTTTGC. sgRNA #1: GCGAGACCCAATGCGAAATT; sgRNA #2: TTCACATTAGGCTATTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7040 |
C. elegans |
ZK512.2(hd7040[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 2129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGGCCTTTCTCTTCAAAGCCTTCTTCTCCT; Right flanking sequence: CTATGCTTTTTCTTGTATATTTCAAACATT. sgRNA #1: TGGAACTGGTAGAAAAGCAG; sgRNA #2: CATAAAATGGGTCAGAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7041 |
C. elegans |
ech-3(hd7017[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACTATGGGTGCGATTGTGGCGAATCCCA; Right flanking sequence: TGGCTGATAGAGAATCCACGTATTACTCGT. sgRNA #1: GGCACACTCGGGTTTCAAAG; sgRNA #2: TCATCCGGAAATATGCATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7042 |
C. elegans |
mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGACATAGTGACACGCATTGGAAGCCG; Right flanking sequence: GGGAAACTCCGCCCACAAACGCTGAAAGTT. sgRNA #1: AACTATTTCAATGGTTCAGT; sgRNA #2: CCACACTCTCCGAGCAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7043 |
C. elegans |
mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATAAGAAAGTTTTTTTTTTAATTTTTAA; Right flanking sequence: ATGCCCGTTGCCATGCCGTTGTTCCGATAG. sgRNA #1: AAAGCTGTCTCACAAAGTAA; sgRNA #2: GAGGAGGAAAGGAATTAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7044 |
C. elegans |
otpl-5(hd7011[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAAATGAACAAAAAGTTACGGAGGAGGC; Right flanking sequence: ATTTCCCATCAAACTGCCTGATAGCTACTC. sgRNA #1: GAACTCCCACCCTCCCTTAA; sgRNA #2: CCAAAGTTCAATTCAGTAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7045 |
C. elegans |
cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7046 |
C. elegans |
ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7047 |
C. elegans |
gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7048 |
C. elegans |
gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7049 |
C. elegans |
efl-2(hd7049[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4502 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGCTCGAGGGGCTCGGTTATGTGGAGA; Right flanking sequence: GGGCTTACCATTTTGTGGGCGTGGTTAGCT. sgRNA #1: GCTCGGTTATGTGGAGAAGG; sgRNA #2: CACAAAATGGTAAGCCCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7050 |
C. elegans |
sknr-1(hd7050[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2851 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAGACCCGGCAAAGAAACAAAGATTATC; Right flanking sequence: GCATGGCATTTCATCAAGAACAAAGAGATA. sgRNA #1: AAGAAACAAAGATTATCGTG; sgRNA #2: TTGATCGTGACTACATGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7051 |
C. elegans |
shw-1(hd7051[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 18084 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCATTACAGGCTCAAGGGAAAGAACCTCGG; Right flanking sequence: TGGAGGTTTTTGCTCCGAGCATGATCCGAG. sgRNA #1: TGAGTGAATTGAGTTGTCCG; sgRNA #2: CGACGTGTACTCATCTTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7052 |
C. elegans |
ZK1058.3(hd7052[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAACAATCAATCTTAAATCCGCTTGCTCC; Right flanking sequence: CGCCGGAGATTGCTGCAAAAACGCTGAGCG. sgRNA #1: TTAAATCCGCTTGCTCCCGG; sgRNA #2: AAAACAACGGGATCTTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7053 |
C. elegans |
ZK697.8(hd7053[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATTGGTAAATTTAGAATTTCAAGGTATC; Right flanking sequence: TACTGGCCTAAAAGATAAAAAGTCTTGTTT. sgRNA #1: TAGAATTTCAAGGTATCGGC; sgRNA #2: TGCATATGATTTCCTAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7054 |
C. elegans |
R09H10.3(hd7054[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 695 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAGAAAACTCCGCACACAAACCTCATTT; Right flanking sequence: CCCTGGAACCTACCGATTGGTCTACATCAC. sgRNA #1: GCACACAAACCTCATTTCGA; sgRNA #2: CCCGATTTCACCCTAATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7055 |
C. elegans |
rfth-1(hd7055[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain. Homozygous early larval arrest without immediately obvious morphological defects. Deletion of 4370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCGTCAGCTGCTCCTTCGTGTCGCCCCT; Right flanking sequence: CCTAAAACATCGTTATTGATCCTCCGCAAA. sgRNA #1: ATAGTATGGAGAGAGCCCTC; sgRNA #2: ATTAGTGAATGTGAGGTGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7056 |
C. elegans |
cest-13(hd7056[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 4312 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAACATATGATGTGACAGTGCAAACACCA; Right flanking sequence: GCCTCAGTAGAGGTCCTCCGCCCCATCTTT. sgRNA #1: CGTATCGTTGCAGATCCATT; sgRNA #2: CATGTCACAACACGTAGGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7057 |
C. elegans |
tmem-39(hd7057[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1785 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCAATCCGACGACAATTGCAAGTTGAC; Right flanking sequence: CGGAAGGAGCTTGTGGTGGAGGTGCCGGCA. sgRNA #1: ATTCCCATACCTCGTTGATG; sgRNA #2: TCTTGGGATTGAAGCTGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7058 |
C. elegans |
ctf-18(hd7008[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7059 |
C. elegans |
prk-1(hd7059[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 11634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTCCTGGGGCACCGCCTACTTTTGCCGCCG; Right flanking sequence: CGAAAGAAATCGAGTATTTTCAAATCATTT. sgRNA #1: ATTGCTGACGGTGGGCGCGG; sgRNA #2: CATCCGAACTAAATTATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7060 |
C. elegans |
asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2624 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATGATGAACTTGATGAGATAAACTG; Right flanking sequence: CGGAGGACAAAACTTCGATCTTCAAGGAAA. sgRNA #1: CTTGATGAGATAAACTGATG; sgRNA #2: AACATCACCTTCAACCTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7061 |
C. elegans |
F10E9.4(hd7061[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAACGAGGATGGAACTACAGAAGTCCAGGA; Right flanking sequence: AGGATATTGATCTCAATAGCTCCAATTAAA. sgRNA #1: AACAGAAAGTGAAGCACCAA; sgRNA #2: ATTATGACTATGTACTTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7062 |
C. elegans |
drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTGAATTGAAAAGGGAGTGGTTTCCCT; Right flanking sequence: CGGCATTGAGTCTGGCGGCTGTTGCCGGTG. sgRNA #1: CCGATTCCGTTCCTAATCAC; sgRNA #2: GATTGGAATGGTGTTATGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7063 |
C. elegans |
kin-14(hd7063[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATGGAAGTTTCGCCCAGCATTGTTTCAAA; Right flanking sequence: TGGCAGTTACAGTTAAGTTACAATATTTGG. sgRNA #1: GCGATTTCAGAAATGGTTGG; sgRNA #2: CAACGAAATTTGGCGCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7064 |
C. elegans |
C08F8.6(hd7064[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCTCGAAAGTCAATCAATACAACTCCT; Right flanking sequence: AGGTCTCCTTTCGGGTTGGAACACTTGTAG. sgRNA #1: CCTTCTTATCGTCTTCATAC; sgRNA #2: CCTCGACTTTAAGTGCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7065 |
C. elegans |
T23G7.2(hd7065[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1233 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCAGTAATTCCAACACCCAAACTTCGCTC; Right flanking sequence: TGGGGCATAATACATAAAATAAATCGCTTG. sgRNA #1: ATTCCAATCATTTTCATGGG; sgRNA #2: AAACAAACCTGGAGAAATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7066 |
C. elegans |
pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7067 |
C. elegans |
T25B9.2(hd7067[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTCGGCAGGAGTTTGTTTTTTTTTCCT; Right flanking sequence: TGGTAAAAAATGTTCTACAATTTTTTACAT. sgRNA #1: ACATTATTCACAGTACTCAC; sgRNA #2: GTTAGAAATCATTACATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7068 |
C. elegans |
Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCAAATTCGGTCAGTGTACTGAAAATC; Right flanking sequence: CAATAATGCTGAGGAAAAAAGCTTCGAATA. sgRNA #1: TCATCCTTCATTTGTCTGGG; sgRNA #2: GAATTTTCAGGCAACACTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|