| PS8430 |
C. elegans |
frpr-17(sy1302) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-17. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCAGTTAATCAGTCATGATATTATCGATCCAAGCT right flanking sequence: CAGTGGGATTTCAAAACTGTGAACCTTTGgtgag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTATCGATCCAAGCTCAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8432 |
C. elegans |
frpr-19(sy1304) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-19. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATGATTGGCTCAACAGAGGTGCCGTTGTTTGAGG right flanking sequence: AGGAGGATATGTGTACACCACTCAACATTTCTTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTGCCGTTGTTTGAGGAGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8441 |
C. elegans |
daf-2 (e1370) III; glo-1(sy1306) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8442 |
C. elegans |
npr-26(sy1307) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCCCGATGGGATTTTGTATTGTCCAAATCACAC right flanking sequence: TGGTGGTCCCGTCTGGGTACGCAATGTCTATCCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTGTCCAAATCACACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8444 |
C. elegans |
npr-21(sy1309) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTGTATCCTACCTTTTTGTCTTTCTGGCCACTAT right flanking sequence: AATCGgtatgccaaggatctttgttcatattttta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCTTTCTGGCCACTATAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8450 |
C. elegans |
npr-27(sy1315) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-27. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gggtgtgccttcttgATGGAGGATTTTTCCTCGA right flanking sequence: ATTTCACGACAACTTCAATTCAGAATGATAGTTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAGTTGTCGTGAAATTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8453 |
C. elegans |
syIs534; syIs300 Show Description
syIs534 [flp-20p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + inx-11p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for gland cell. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8459 |
C. elegans |
syIs589. Show Description
syIs589 [15xUAS::wrmScarlet::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] mScarlet cGAL effector.
|
|
| PS8461 |
C. elegans |
syIs591; syIs300. Show Description
syIs591 [srh-142p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADF neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8462 |
C. elegans |
syIs592; syIs300. Show Description
syIs592 [srh-200p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADL neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8463 |
C. elegans |
syIs593. Show Description
syIs593 [15xUAS::rlp-22HA::SL2::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Tissue specific RNA-seq cGAL effector.
|
|
| PS8466 |
C. elegans |
syIs605. Show Description
syIs605 [15xUAS::iC1-C2-TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Chloride-conducting channelrhodopsin cGAL effector.
|
|
| PS8470 |
C. elegans |
syIs609. Show Description
syIs609 [15xUAS::nCRE::SL2::GFp::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Nucleolus-transport-enhanced Cre protein cGAL effector.
|
|
| PS8476 |
C. elegans |
syIs615. Show Description
syIs615 [15xUAS::lmp-1::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Lysosomal associated membrane protein cGAL effector.
|
|
| PS8484 |
C. elegans |
npr-31(sy1360) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-31. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaaaaactagttataaaaatgttcagATCCCTTA right flanking sequence: TGTCCAGAAGCTCCCCTTCAGATCGATTACGTGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGGGAGCTTCTGGACATAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8486 |
C. elegans |
frpr-8(sy1362) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTATTTCGCTTCTTAATAATTCTACACTGGTCA right flanking sequence: CTACGGATCAGCCAGGTTTTTCTGGAAGTACAAAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAATTCTACACTGGTCACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8488 |
C. elegans |
frpr-2(sy1364) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTATGCGTGAGTGTGAATGCCTTCATGAGCCGATA right flanking sequence: GAGGGGTACGCGGGAGTTGCCAATCTGgtaagtatac inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTCCCGCGTACCCCTCTAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8490 |
C. elegans |
frpr-16(sy1366) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-16. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cacattATGAATCGGTACGAGTTCTACGAGCTAAAA right flanking sequence: TCATGGATGTATTTACCTGTAATTTTCATTGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGTTCTACGAGCTAAAATCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8496 |
C. elegans |
syIs627; syIs300. Show Description
syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8498 |
C. elegans |
syIs629. Show Description
syIs629 [15xUAS::ChR2(C128s)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stable step function ChR2 variant cGAL effector.
|
|
| PS8501 |
C. elegans |
syIs632. Show Description
syIs632 [15xUAS::myri::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Cell membrane labeling fluorophore cGAL effector.
|
|
| PS8504 |
C. elegans |
syIs635. Show Description
syIs635 [15xUAS::hChR2(C128s, D156A)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stabilized step function Opsins ChR2 variant cGAL effector.
|
|
| PS8505 |
C. elegans |
syIs636. Show Description
syIs636 [15xUAS::miniSOG-103L::VAMP2::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector.
|
|
| PS8508 |
C. elegans |
syIs639. Show Description
syIs639 [15xUAS::SwiChR::TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Step-Waveform Inhibitory Channelrhodopsin cGAL effector.
|
|
| PS8527 |
C. elegans |
oac-56(sy1372) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-56;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTTTGTTTTACTATTTCACTTGAACCCTAACCTATT
Right flanking sequence: TGTTAATGGATTTCTCGGTGTTGATATgtaagccc
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctag. sgRNA : CGAGAAATCCATTAACAAAT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8529 |
C. elegans |
oac-57(sy1374) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-57;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CGATATCATTTGCATTCAATTTTATTCTTCCATCT
Right flanking sequence: AAAGTCTCTTTTAACAGTTTGCTTGCAAGAATATG
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGTTAAAAGAGACTTTAGA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8538 |
C. elegans |
oac-35(sy1390) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-35.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GATTTCTAATGTGCATGTTGCTCAAGCGTGCCGAGA
right flanking sequence: CCCACCCATTTTTCACGTTGTTATGCACATTTTAC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGTGAAAAATGGGTGGGTCT
Method Reference: G3 (Bethesda).
|
|
| PS8553 |
C. elegans |
syIs654. Show Description
syIs654 [15xUAS:VSFP-Butterfly-1-2::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Voltage-sensitive fluorescent protein cGAL effector.
|
|
| PS8556 |
C. elegans |
syIs657. Show Description
syIs657 [15xUAS::act-2::Venus::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. cGAL effector for localiziation of actin filament and cell cortex
|
|
| PS8558 |
C. elegans |
syIs695. Show Description
syIs659 [15xUAS::miniSOG-103L::mCherry::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Reactive oxygen species production cGAL effector.
|
|
| PS8562 |
C. elegans |
syIs663; syIs300. Show Description
syIs663 [gcy-33p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for BAG neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8565 |
C. elegans |
syIs666; syIs300. Show Description
syIs666 [str-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8580 |
C. elegans |
oac-36(sy1411) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTAATGTGCATGTTGCTCAAGCGTGCCGAGACCAAGC right flanking sequence: CATTTTTCACAGTGGTATGCACATTTTACACGAGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACCACTGTGAAAAATGGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8586 |
C. elegans |
npr-9(sy1417) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCATCATTGCCTCTTCAGTAAATACACGTTCACC right flanking sequence: CATAGgtgtataattgaacttatgtatatgttttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAAATACACGTTCACCCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8642 |
C. elegans |
syIs672; syIs300. Show Description
syIs672 [gcy-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AFD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8643 |
C. elegans |
syIs673; syIs300. Show Description
syIs673 [rig-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for SAA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8648 |
C. elegans |
syIs678; syIs300. Show Description
syIs678 [flp-8p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for URX neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8650 |
C. elegans |
syIs680; syIs300. Show Description
syIs680 [gcy-5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASEL neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8653 |
C. elegans |
syIs683; syIs300. Show Description
syIs683 [gcy-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASE neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8660 |
C. elegans |
syIs690; syIs300 Show Description
syIs690 [tph-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR +pdf-1p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. [NOTE: Pick animals with RFP+ coelomocytes to maintain. Array appears to be lost or silenced in some animals.] Split cGAL driver for NSM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8661 |
C. elegans |
syIs691; syIs300. Show Description
syIs691 [pdf-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + grl-2p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for MCM neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
| PS8687 |
C. elegans |
nlp-32(sy1459) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-32.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCTACTTGTATTCTGTCTTATCGCATTGACCGCCT
right flanking sequence: TGCCGGTTTTCTCTTTTCCAAATGGGCTAACTATG
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAAGAGAAAACCGGCAAGG
Method Reference: G3 (Bethesda).
|
|
| PS8689 |
C. elegans |
nlp-33(sy1461) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-33.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCTTCTCTTTGCCATATTGGCTATCGTTGATGCCCA
right flanking sequence: GTGGGGATgtaagttttcaataacttgtttctg
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTATCGTTGATGCCCAGTG
Method Reference: G3 (Bethesda).
|
|
| PS8695 |
C. elegans |
lgc-16(sy1467) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-16;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: GTCACATTATTTTCATTTTCTGACATTTCCGCAT
Right flanking sequence: TTTATCATGATCCAGGATTATATGgtaaagtttgg
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCTGGATCATGATAAAATG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8708 |
C. elegans |
lgc-22(sy1478) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-22. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGCTTCTCATTGCCACGTCACTGGCCGCCACGTTA right flanking sequence: GCGTGGGCGGCGGGCACCGCCGGCGGCTGCGAGGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACTGGCCGCCACGTTAGCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8713 |
C. elegans |
lgc-32(sy1483) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-32.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GATTGCACAAGTGATGAAGATGTGATTGCTGATCT
right flanking sequence: CTTAGGAAGAAATTCACATTCTTCTGgtaacttattg
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATGTGATTGCTGATCTCTT
Method Reference: G3 (Bethesda).
|
|
| PS8721 |
C. elegans |
lgc-30(sy1486) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-30.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GCTTCATCCCGAAAAAACTAATAAAAAAGCCGCCG
right flanking sequence: GCTATCGACGACACGGCGTTTCATCGGCGTCGAGC
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCCGTGTCGTCGATAGCCGG
Method Reference: G3 (Bethesda).
|
|
| PS8725 |
C. elegans |
lgc-28(sy1490) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-28.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CAGCTTAAATATTCAACTGGAACCTTCTCCTGGCG
right flanking sequence: AGATGGAGAAAAGATATGAAGCTGAGgtatgtttttc
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACCTTCTCCTGGCGAGA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8727 |
C. elegans |
lgc-37(sy1492) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-37.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CATAATTCCCATCATTGCTCTAATCCATGGACATCATT
right flanking sequence: CTCAGGCTGTCATAGACATGAAGAGACAACGgtaag
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATCCATGGACATCATTCTC
Method Reference: G3 (Bethesda).
|
|
| PS8743 |
C. elegans |
lgc-36(sy1502) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-36.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CCGGAAGTTTTCGTATAAAACGAACTGTTCACCCT
right flanking sequence: AAAAGgtaagtaaccatctaattcaactattttttc
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGAACTGTTCACCCTAAA
Method Reference: G3 (Bethesda).
|
|