More Fields
Strain Species Genotype
CHS1064 C. elegans npr-20(yum1426) II; npr-18(yum1425) npr-21(yum1427) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS8444 C. elegans npr-21(sy1309) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTGTATCCTACCTTTTTGTCTTTCTGGCCACTAT right flanking sequence: AATCGgtatgccaaggatctttgttcatattttta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCTTTCTGGCCACTATAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616