More Fields
Strain Species Genotype
PS8727 C. elegans lgc-37(sy1492) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-37. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATAATTCCCATCATTGCTCTAATCCATGGACATCATT right flanking sequence: CTCAGGCTGTCATAGACATGAAGAGACAACGgtaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATCCATGGACATCATTCTC Method Reference: G3 (Bethesda).
OH14544 C. elegans pha-1(e2123) III; otEx6800. Show Description
otEx6800 [lgc-37(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 3-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14546 C. elegans pha-1(e2123) III; otEx6802. Show Description
otEx6802 [lgc-37p::GFP + pha-1(+)]. Maintain at 25C to select for maintain array. Reporter contains 5 kb of lgc-37 promoter fused with GFP. Derived from injection of pMG249; line 5. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.