| PS8727 |
C. elegans |
lgc-37(sy1492) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-37.
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: CATAATTCCCATCATTGCTCTAATCCATGGACATCATT
right flanking sequence: CTCAGGCTGTCATAGACATGAAGAGACAACGgtaag
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATCCATGGACATCATTCTC
Method Reference: G3 (Bethesda).
|
|
| OH14544 |
C. elegans |
pha-1(e2123) III; otEx6800. Show Description
otEx6800 [lgc-37(fosmid)::SL2::NLS::YFP::H2B + ttx-3::mChopti + pha-1(+)]. Maintain at 25C to select for array. Reporter tag inserted into fosmid WRM0640aC06. Line 3-2. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
|
|
| OH14546 |
C. elegans |
pha-1(e2123) III; otEx6802. Show Description
otEx6802 [lgc-37p::GFP + pha-1(+)]. Maintain at 25C to select for maintain array. Reporter contains 5 kb of lgc-37 promoter fused with GFP. Derived from injection of pMG249; line 5. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
|
|
| OH19094 |
C. briggsae |
Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19123 |
C. tropicalis |
Ctr-lgc-37(ot1487[Ctr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-lgc-37 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|