More Fields
Strain Species Genotype
VC1902 C. elegans lgc-4(ok2567) X. Show Description
F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
KRA586 C. elegans pha-1(e2123) III; kasEx275. Show Description
kasEx275 [lgc-4::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with lgc-4 genomic region (-669 to +1,797 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
MT14678 C. elegans lgc-40(n4545) X. Show Description
1.029 kb deletion in T24D8.1 encoding ligand-gated chloride channel that is a low affinity serotonin receptor. Homozygous viable.
NFB1149 C. elegans vlcEx651. Show Description
vlcEx651 [lgc-49p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains lgc-49 enhancer sequence (-2649, -1782) inserted into pDD95.75. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
PS8729 C. elegans lgc-41(sy1494) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-41. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCGGCCACCAACAGCAAATGCATCAGTACCACTC right flanking sequence: GGTGTCAAACTTGGAATGTATTTGGAGAGTCTCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCCAAGTTTGACACCGAG Method Reference: G3 (Bethesda).
PS8731 C. elegans lgc-43(sy1496) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cttctaattttcagAAGTTTTAACAACCGAAG right flanking sequence: CGTCAACTGATTCTTCTTCTCCAACATCGAGCATATTTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGAAGAATCAGTTGACGCTT Method Reference: G3 (Bethesda).
PS8741 C. elegans lgc-44(sy1500) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTATTTCTCTTCTTTTTCTAATATTTCCACAT right flanking sequence: TCATCTAATCCTTCAAGCTCTAATTTTCTGGATATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTGAAGGATTAGATGAATG Method Reference: G3 (Bethesda).
PS8742 C. elegans lgc-47(sy1501) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCCACATTGTTTCTGTTGCTCTATGCCACCCGGG right flanking sequence: AAACGGTCAATGCAATGACTGCCGAGATCAGCCC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGCATTGACCGTTTCCC Method Reference: G3 (Bethesda).
PS8747 C. elegans lgc-48(sy1506) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-48. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagcttcATGTTTTTTCATATTTTTTTGGGCCTACT right flanking sequence: GGTCGCTGTTTTGGGTGAAGAAGTTCATGAACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCCAAAACAGCGACCAGT Method Reference: G3 (Bethesda).
PS8865 C. elegans lgc-42(sy1550) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-42; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAATGGAAATCCGAAGGCTCCGCTGCAAGTGCA Right flanking sequence: CTTTGGTTTTTATGTGGAGAGCTTGGGAAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCCGCTGCAAGTGCACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
RB2187 C. elegans lgc-47(ok2963) X. Show Description
F47A4.1. Homozygous. Outer Left Sequence: GCCCGAAGAAGATTACCAAA. Outer Right Sequence: ACGACCCAACGAACAGAAAC. Inner Left Sequence: TCCTTTCATTCTTTTGCTCACA. Inner Right Sequence: AAGCGGAAAGTGTTTCTCCTC. Inner Primer PCR Length: 1179 bp. Deletion Size: 521 bp. Deletion left flank: GTCATATAGGTTGGAATGTAACCTTGCAAG. Deletion right flank: TACTAAAGTTTGTCATTGTGAAATCAGGTA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2209 C. elegans lgc-46(ok2949) III. Show Description
Y71D11A.5. External left primer: CCAGTTTCAGCTGTGTCGAA. External right primer: GTTTTGCACGTACTTCCACG. Internal left primer: AAACTAGGCTTGTTGGGGGT. Internal right primer: CGAAGCTAATAATGGTGCCAA. Internal WT amplicon: 1314 bp. Deletion size: 492 bp. Deletion left flank: TCCCGGGAGAGGTAGCCGACCCAGGCGAGT. Deletion right flank: AACTCCCACGAATTTCTAGATAAACTCACT. Insertion Sequence: CCCACGAATTTCTAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3750 C. elegans lgc-45(gk3708[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 761 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGGACCAATGGATCTACGAAGTAAGTTG. Right flanking sequence: CGGCGAAAAGACGCCATCGACAAAAATCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.