Search Strains

C04H5.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2475 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCCTACGTGGCAAGTACA. External right primer: AAAATGACTCACGAAACGGG. Internal left primer: TGCACGTGGCAAGGTATCTA. Internal right primer: TGCAAAAATGTTGGAGAGCA. Internal WT amplicon: 3309 bp. Deletion size: 1504 bp. Deletion left flank: TTGCAAATTCGGCAGAAGTTGCAGTGTATG. Deletion right flank: TTCAAAATGAACTTCCATACACTTACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D11.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2419 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCCGAAATGAGACACCAC. External right primer: CCCACCCTCGATTTACAGTC. Internal left primer: GTTTTCGGTCGGTAGAGCAC. Internal right primer: TTTGAAATCGATCGAAAAATTG. Internal WT amplicon: 3161 bp. Deletion size: 2665 bp. Deletion left flank: TAGTTTTTCAATAAATAAATACACTTTTTT. Deletion right flank: GTTGGCAATCGCTTTGGAACGACTTCACGA. Insertion Sequence: AATCCTGAGCAAAAAAGTTAAGTAGTTGAAAAAAAGTTAAGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1268 bp. Deletion left flank: GTGGTGAGGATGATGTTATCATTCCTGAAT. Deletion right flank: CGTTGAAGAAGCGAAAAAGAATGCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55A12.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2578 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAGGGATGACTGTTTTGGC. External right primer: ATTACGGCTTCCACGTTTTG. Internal left primer: TGGCTTGAAGGATATTGGGA. Internal right primer: ACATGTCGATTTCCGGTCTC. Internal WT amplicon: 2261 bp. Deletion size: 1825 bp. Deletion left flank: TAAAGATAATATAGAAAAAAAAAATTTCGG. Deletion right flank: AAACTCACATTTCCTTTGAGGTCCAAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2321 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATGGCAGGAATTGTTT. External right primer: GCGGTAACGGACTTTGTCAT. Internal left primer: GAAATGAGCACGGGGATTTA. Internal right primer: GCTTCTTCATGTGACTGGCA. Internal WT amplicon: 2913 bp. Deletion size: 1384 bp. Deletion left flank: TATTTTATTTGGTTTTACCTGACTCTGACT. Deletion right flank: AACAGTTTACTTAATAATCAGCTTTATTGA. Insertion Sequence: ACAGTTTACTTAATAATCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A3.2. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2496 homozygotes (probably viable Dpy, sometimes blistered, often sterile). Use care when maintaining - viable WT non-GFP animals are most likely rare recombinants. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAATTTTCACCTGCCTCA. External right primer: AAGGAATAAGGGGGTCATCG. Internal left primer: GCATGCAGCACTAATTTCCA. Internal right primer: TGTAGTCCAACATTGGCGAG. Internal WT amplicon: 2328 bp. Deletion size: 1024 bp. Deletion left flank: AAAAGTTGTTAAAACAAAAGGCTTACCTGG. Deletion right flank: GACAAAAGGATAAAGTCGACATTTTTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2621 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCTGCACAGCCTTCTCAA. External right primer: GAGCAGGTCTACCCTTCACG. Internal left primer: AGATAATGCCACCACAGGCT. Internal right primer: TGTTGAAGCAGGTGGAATTG. Internal WT amplicon: 3165 bp. Deletion size: 2394 bp. Deletion left flank: AGGAATCAATGCAATATGGTCACCAACAGA. Deletion right flank: AAGTTGCATGTTAAGATAAAAGCTTCACCA. Insertion Sequence: CATATAATAAGTACAATACATACAATATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25H3.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP o2632 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTGTTGAGCTTTGTTCCCA. External right primer: AAATCGATGAAAATTCCGCA. Internal left primer: AATCAACGCTCACTCGCTCT. Internal right primer: GGAATTCGAAAACCACGATG. Internal WT amplicon: 3051 bp. Deletion size: 1740 bp. Deletion left flank: CTCTCCTGGTTCCCATATTGTAGTTGGACG. Deletion right flank: ACTGTGTCATCTGATGCCTCGTCAATTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0511.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2607 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATCTCCGTGTTTGCCACA. External right primer: GATGAGAAATCCCTGACCGA. Internal left primer: TCGCCTTGACTTTGTCTTGA. Internal right primer: GACTCCGTTGTTGCCATTTT. Internal WT amplicon: 1140 bp. Deletion size: 578 bp. Deletion left flank: GTTCAGCTTCCTCTTGGCTCATATTCAATC. Deletion right flank: CCATTCTTGGAGCAGAATTTCACTGGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09C2.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2532 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGTTAGAAGCTGACGAGCG. External right primer: TGAATCCGATCCAGTTCTCC. Internal left primer: CAGTCGGCAGATTTCACAGA. Internal right primer: CCGGAAAAATGCTCATCACT. Internal WT amplicon: 3166 bp. Deletion size: 1418 bp. Deletion left flank: TCGCGGATTCTCTCATTGAATTCCTTTCCT. Deletion right flank: ACTTTTCCATTTTCGTCGCGGATTCTCTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation, and homozygous for unlinked pharyngeal GFP insertion mIs12 (artifact of strain construction). Balanced lethal heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2238 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.External left primer: CAATCTTCGAGCCTGGGTAA. External right primer: TACCTTCCAGTCCAGATGCC. Internal left primer: TGAAATGGCGATTTTGATGA. Internal right primer: CATGATATGGCGATGCAAAG. Internal WT amplicon: 2918 bp. Deletion size: 1120 bp. Deletion left flank: TTTCTCCATACTACGTCCTCCGAGACTTGA. Deletion right flank: AATGAAACGATTTCCTCGTTGAGACGTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03F11.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2598 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGACAAGGCAATGAGACC. External right primer: TGGGAGCTTTAATCGAAGGA. Internal left primer: GCCAAGTCCAACAGCTATCC. Internal right primer: CAATTGCTCTTTTCGGGCTA. Internal WT amplicon: 1231 bp. Deletion size: 302 bp. Deletion left flank: GTAAATCCCCATTGCAAACAAAAAAAGTGT. Deletion right flank: CAGTACGTTTTATTAGCGTAGGGCCACCTA. Insertion Sequence: ACCAACGCCGAGTTCGGGTCCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK973.10, ZK973.9. Homozygous lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2652 homozygotes (late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGAGGCTGTTGTTGGTT. External right primer: GAATCGGCGCTACTCATCTC. Internal left primer: GCAGCGGTACCATCATCTTT. Internal right primer: TTACAACGGGAGACAAAGGG. Internal WT amplicon: 2218 bp. Deletion size: 1384 bp. Deletion left flank: ACTCCTTTTTTGCAAAAAAAAACAAACAAA. Deletion right flank: TGCTTGTACGAGAACACATACCATTCCCTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G10A.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATGGTTTTCGCAGTTT. External right primer: TGACATGCAGCCTCTAATGG. Internal left primer: ATTCTGCGTCTCCTGCATCT. Internal right primer: AAAAGTGAACACGGCCTTTG. Internal WT amplicon: 2246 bp. Deletion size: 1628 bp. Deletion left flank: AAAAGAGCATCATGCTCTCCGTCACAGCGT. Deletion right flank: TTTTAAAAAAGTTTTGGTTTTTTTTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28D9.10, T28D9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2084 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTTCCGCAAAGTGCATAAT. External right primer: CTAGGAAGAGCGCGAACAAC. Internal left primer: GTTGACTCGGAAAGCCGTAA. Internal right primer: AGGAAGCGGTGTCCTACTCA. Internal WT amplicon: 3125 bp. Deletion size: 1493 bp. Deletion left flank: AGTATAGGACGTTCGATACTCAAATTTGCT. Deletion right flank: CGTGATCGCAAACGTTCTCGCAGATCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B8.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2521 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Note that ok2521 was subsequently isolated as a viable homozygote (VC2085), so the lethality in this strain is not a consequence of the deletion. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 540 bp. Deletion left flank: AGCCAACGGCATGCTGGTTATGCTCACCTT. Deletion right flank: TGTGACTTAAGACTTTCTGGCAATGATTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16D3.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2634 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGGGAGATTCAAATAAGG. External right primer: TTTTGCAGCAATGGATGAAG. Internal left primer: CAAAACGCGTCTCCATTTTT. Internal right primer: ATGCACCAGTCGATGAGTCG. Internal WT amplicon: 1161 bp. Deletion size: 464 bp. Deletion left flank: CCGTCAAAACTCTCCGATCAACGTGTTTGA. Deletion right flank: CGTACAATACACAAATCAGAAAGATATTTC. Insertion Sequence: CAAATACACAAATCAGAAAGATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0336.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk910 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTACCCCATTGGTTCCTCCT. External right primer: TCAATTCCATCTCGAGGTCC. Internal left primer: ATTCTCGCATTTCTTTGCGT. Internal right primer: ATTTGGGCTGCAATCTCATC. Internal WT amplicon: 2166 bp. Deletion size: 408 bp. Deletion left flank: ATGGTTCCACTCCCGGCTACCGCTCCTAAT. Deletion right flank: CTTCAAGTTGCCAAGATTCCACCAGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK616.4, ZK616.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2654 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTCTGTCCCATGTCTGCTC. External right primer: TGTTACAATTTGATGGCGGA. Internal left primer: CGGAATTCAAAATCCTGGAA. Internal right primer: TTCAGGGGTTCTCTTGGTTG. Internal WT amplicon: 3222 bp. Deletion size: 1966 bp. Deletion left flank: AAGACCGATTGCTCCGAGGTTTCCAAGGCA. Deletion right flank: TACAAGTATTGATATGGACTACGTCGACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E12.6. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk896 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 1777 bp. Deletion left flank: GTTTTGGGAATAAAGCATCTCACAAATAAA. Deletion right flank: CGAATCTACGATATTGTCAATGTAATGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26A8.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk917 homozygotes (Dpyish, late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTTTGGCTCTTCTTGGAT. External right primer: TGTTTGCGCTGAGAGAGAGA. Internal left primer: GCTGAACTAATCCAGGCTGC. Internal right primer: TCCAACGTTCAAGATTCCAA. Internal WT amplicon: 1977 bp. Deletion size: 722 bp. Deletion left flank: TAATTATTATGGAAAAGTGATTTCGATTTT. Deletion right flank: AATTATTCCCATTTATTAATGCGTCAATAA. Insertion Sequence: TTGCTTACCTCCAGGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04F5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk686 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTCAGACCCGCTTTGAGAA. External right primer: CAAACATGGTGCAAGACCAG. Internal left primer: CGAAGAATGCTTGCAAATGA. Internal right primer: TCCTTCGAGCCAGCTGTATT. Internal WT amplicon: 2299 bp. Deletion size: 1150 bp. Deletion left flank: AAGAAACTCTTTTGAGTTACCTCATTTTTT. Deletion right flank: TTTCTCCACGCTACTCCGACACATTATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T15B7.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2680 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCAGACGTATCTGGTTGCG. External right primer: AATGCAGCAGAGAGCGACTT. Internal left primer: ACAACGTGTTACAAATTTTAGGG. Internal right primer: GACTCCTCACGGATGACGAT. Internal WT amplicon: 1144 bp. Deletion size: 925 bp. Deletion left flank: TAATTTAAATTAATTTCAGATGGTCTGCAA. Deletion right flank: TATAAATAATAACACCAATATATGAGATTC. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2476 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTTTCGCCGTTTGATGTC. External right primer: CCGAAAATTAGCCGATTTGA. Internal left primer: TGATAAATGGTGTGCTCCGA. Internal right primer: GATTTATCCGTCAGCCGAAA. Internal WT amplicon: 2623 bp. Deletion size: 1324 bp. Deletion left flank: CTAAGGCCATAAAAATCAACAAAATCTAAA. Deletion right flank: TATTTAGCAGACCAAAGTTGGGTATCCAAT. Insertion Sequence: GAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53A5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2492 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGAATGAAGCGTTTGACGA. External right primer: GACGTGCCCTTGACCATAAT. Internal left primer: CAGCGAAAAACTTCGTTGAA. Internal right primer: CATAGTAGTAGGCGACACGGC. Internal WT amplicon: 2899 bp. Deletion size: 1269 bp. Deletion left flank: ACTGAAATTGTCATTATTTATTTTCTTCAT. Deletion right flank: ATGATCTTGCCGAATTCAGTTTATTGATCA. Insertion Sequence: TTTCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37D8A.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1990 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGATTTTTCTGCGTCTC. External right primer: GGCCAATATGCTTTTCGTGT. Internal left primer: GATACCGTGGCGTTTTTGTT. Internal right primer: CGGGTCTCAACACGAAAAAT. Internal WT amplicon: 2347 bp. Deletion size: 879 bp. Deletion left flank: ATAGAGATTTCGCGTATTTCGCGCACAACA. Deletion right flank: AAAAATCTGTTTTCGGTAGGAATGTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71F9AL.17. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2824 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTTTGACTTTTGCCCCCTT. External right primer: TCAGCAAGGATGTTGCTCTG. Internal left primer: AGCTGTCTGGAAATGTCCGT. Internal right primer: CTCCGTTACCCACAACCATT. Internal WT amplicon: 1146 bp. Deletion size: 766 bp. Deletion left flank: TGACAAGCTTATCCGTATTTCCAGTAACAA. Deletion right flank: AGCCGTGTTGATATTCTCGAGTTTGCGAAG. Insertion Sequence: GATACAAAAACGAGAGCTTCTCAAAGTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H37A05.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2761 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTACACACTCGGCGGTTTT. External right primer: TGTGTTAATTGGCACAGGGA. Internal left primer: TCAATTTCAACTGGATTCGATG. Internal right primer: AATCCTGCCACACTTTCAGG. Internal WT amplicon: 1279 bp. Deletion size: 518 bp. Deletion left flank: CTCGGTCTCAGCAGCGAGAACTGTAAGATC. Deletion right flank: GCTCTACGACAACCACATCGATTGCTCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03G9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTGCACATTTTTCTCG. External right primer: CCGTGAAATTCCCAGTGAAC. Internal left primer: GAAACTTGGAAAACCGCAAA. Internal right primer: GGATTTGCCGAAGATTCAAA. Internal WT amplicon: 2805 bp. Deletion size: 790 bp. Deletion left flank: ATTATTAATATTGAGCTCCCCCATGCCTGC. Deletion right flank: TTCCATTATTCCCGTCCTGAAAAAAAATGA. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y63D3A.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2290 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGCTCCGGATAAACTTGGGT. External right primer: TATTCCCTTCCCACCAATCA. Internal left primer: TTCCAGATGGTGCATTCAAA. Internal right primer: AGACAGGAGCCCGAGATTTT. Internal WT amplicon: 2440 bp. Deletion size: 1264 bp. Deletion left flank: AGCAGATTAAGGTAAGGAGGATTTTGAGCG. Deletion right flank: CCACCACCGCAGGGAGCTCCCCAGCAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04H5.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2708 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCTTCGCCTGCAAATCAC. External right primer: TTCATGCCGTACCTGTTCAA. Internal left primer: TCTTCGATCCCAGTGCTTTC. Internal right primer: AAGGAGCAAAACTTCGATGG. Internal WT amplicon: 3202 bp. Deletion size: 2453 bp. Deletion left flank: ATACCAAAATATCGCCGGGAAGTGGCTGGG. Deletion right flank: GCGAATAAAAGTCGAAAAAAAAATGTTTTG. Insertion Sequence: ATTTTTTTTCGTTTTTTTTTGGGTTTATTCGAAGTATTGATTAAAATTTAAGAGCGATC GATTTTTTTCTTAATTAAAAACAAAAATCCTGAATGTTTGGTTTTTTTGCTGTTTTTGT AAATGTTCTAAAAATTACCTATAACTAGCCAAATCGGGTTCGTTGAGAAACTCTCTGAG CAGCATTCCGTCTGTCATGTATTTGAGGACAGTCTTCTCCGATGTGCAATCCTCGAAAC GAATACTGTAGCCGACCTGGAAAATGGAAGCGTTTCGAAAGAAAAATCGGAATCTGTTT TCCTCGTTTTTTTACAAGTTTAAAAATTTTTAGAAGCGGCAAAGAATTGCCCAAATTTT TTTAACTTCCAGTTTTTTTTTCTAAATTTTGGAATTTTCCGACTAGAATGAAACTTAGT TTATTTTCGCCAATTTCCAAAAACCACCCAACCTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y82E9BR.16. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2740 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCTGGGGATTTTAGCG. External right primer: TATCACCACATTTCCCGTCA. Internal left primer: AATTTGAAAATTTTTGAGGTTTCAT. Internal right primer: TTTCGCGGAAATATTGAACTTT. Internal WT amplicon: 3097 bp. Deletion size: 1978 bp. Deletion left flank: TTTTTTCAAATCGTTGCTAAATTTGAATTT. Deletion right flank: GGGCTTTTTCAGCAATTTCCGGGTAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33H1.4. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk953 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGCCATTCCTTGAAAGGTT. External right primer: GCTAGTAGTCGCTGATCCCG. Internal left primer: GAGGTACCCGTAGATCGCAA. Internal right primer: CGAAATCCGTTCTCCATCAT. Internal WT amplicon: 2555 bp. Deletion size: 836 bp. Deletion left flank: TTGCTCCAAATGCGGGAATTGAAGATAATA. Deletion right flank: GAAGATCGTATTGGTAGATCTGATTTAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2483 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1295 bp. Deletion left flank: TCTATTACTTAAAGCAAATTTTCAAATTGA. Deletion right flank: AGTCTAGAAACAATTATTTTGAAAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37E3.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2787 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAAATATCGGGCTTCAA. External right primer: CCTTCCAATCTGTCCAGGTG. Internal left primer: GCCATCTATCTCCCAAATCG. Internal right primer: ATTAAACCCCCGCTAAATCG. Internal WT amplicon: 1121 bp. Deletion size: 534 bp. Deletion left flank: CTCAAAATCTTGCTATTTTCCTTTGTGATC. Deletion right flank: GCGGATTGTTCCGCCTTTTCTGTAAGTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26H9.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2605 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTGCTGAAAACCGTCACAA. External right primer: GCTCATTCACTGGCTGAACA. Internal left primer: TTGCGTTGATTTCGAAGTTT. Internal right primer: TTCGAGGGGAAAACAATGAC. Internal WT amplicon: 1186 bp. Deletion size: 359 bp. Deletion left flank: GAAAGACGTAAAAACGTTAATAATTAAGAA. Deletion right flank: ATAAAAACATGTTAACAGAGTACTGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2877 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTGGACAGCGTTTGCTT. External right primer: CCATGATTAAACCAGACGGG. Internal left primer: TCAATCCATTGGGCATTTTT. Internal right primer: GGAATTACCTGCAATGGCTC. Internal WT amplicon: 1331 bp. Deletion size: 689 bp. Deletion left flank: AGATAATAATTTATACGAGAATATAGAATC. Deletion right flank: GGTTTCGTCATTTCTCGATAGAATTTGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14D12.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2760 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGCCAACTTTCAGTGGTT. External right primer: TGCGCTTTTTCAATTCTGTG. Internal left primer: CGACCACAACCATATCAACG. Internal right primer: CGTTTGCATGTTGGTTTCAT. Internal WT amplicon: 1239 bp. Deletion size: 516 bp. Deletion left flank: GGATGTTTCTGTTGTGAGATTTGCAATAAA. Deletion right flank: AACAGCACTTCCACAAGGTACTTGAAATAT. Insertion Sequence: AAGATTTGCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20F5.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2856 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCAAAAAGCTGCGATATG. External right primer: GCAAACAGCTGCTGAAACAA. Internal left primer: ATGCACTTGGCACCTTGATT. Internal right primer: CGGAAGAAAACTGGGAGAAA. Internal WT amplicon: 1272 bp. Deletion size: 675 bp. Deletion left flank: GTCAAATAGTGCGCATTGGGCGCGCACACC. Deletion right flank: ATTATGGATCGTGAATACAAAAAAGGTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC250.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2873 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTATCCCAAATTCCCTT. External right primer: CGTTTCATTGGGATACCTGG. Internal left primer: TTTTTGCAAATTTCCATCCG. Internal right primer: AATCTTGGCATCCACCTCAC. Internal WT amplicon: 1225 bp. Deletion size: 429 bp. Deletion left flank: TTAATAGGAAGCTGAGAATGTCAATTTTTG. Deletion right flank: AACTGATGAAAAATGGAAGAATTTAGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42C1.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2912 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCGCTCGGAGAGTTGTACC. External right primer: ACGTGCTACCGTAATCCGAC. Internal left primer: TCGCACTTACCGTATCCACA. Internal right primer: TGATCCTGAAAAGGGGACAG. Internal WT amplicon: 1205 bp. Deletion size: 429 bp. Deletion left flank: TTTCGAAAGAGAATCCATAGATAGTCGATC. Deletion right flank: TCCTTTAAGAATTGGTGTTGAAAAGACTAG. Insertion Sequence: TCAACAAGCTATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC395.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2968 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTGCCCATGGAAACTGATT. External right primer: CAATGCCATTCGCACTTAAA. Internal left primer: GAAAAACGAATGCGGGATAA. Internal right primer: TCTTGCTTGTTATTGCCGTG. Internal WT amplicon: 1196 bp. Deletion size: 501 bp. Deletion left flank: ATCCGTTCGCCATTCCACCGCCAATTCCGG. Deletion right flank: TAATTCGAAAAGAGAACTAGACGGATACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807