Search Strains

Superficially WT.

Male mating response defect.

Isolated at 2151 Bunker Ridge Road, Eugene, OR. From damp grass compost in a field.

Isolated in northwest Hendricks Park, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.

Isolated in northwest Hendricks Park, northwest rhododendron garden, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.

Male-female strain. Low fecundity and fitness. PX356 is an inbred strain derived from EM464. Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.

Inbred strain with low fecundity and fitness. Originally collected in Wuhan, China. Reference: Adams PE, et al. Mol Biol Evol. 2023 Mar 4;40(3):msad039. doi: 10.1093/molbev/msad039. PMID: 36807460.

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

oyIs14 [sra-6::GFP + lin-15(+)].

oyls17 [gcy-8p::GFP + lin-15(+)]. AFD neurons are marked with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

oyIs17 [gcy-8p::GFP + lin-15(+)] V. Thermotaxis defective. Reduced gcy-8::GFP expression in AFD at 25C.

oyIs17 [gcy-8p::GFP + lin-15(+)] V. Thermotaxis defective. Reduced gcy-8::GFP expression in AFD at 25C.

oyIs18 [gcy-8::GFP]. GFP in AFD.

oyEx45 [nhr-82::GFP + coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.

oyEx38 [nhr-77::GFP, coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.

Thermotaxis defective.

oyIs44 [odr-1::RFP + lin-15(+)]. Bright RFP in AWB and AWC.

Superficially wild-type. Reduced dauer formation in response to specific ascarosides. Reference: Kim K, et al. Science. 2009 Nov 13;326(5955):994-8.

Superficially wild-type. Reduced dauer formation in response to specific ascarosides. Reference: Kim K, et al. Science. 2009 Nov 13;326(5955):994-8.

ytEx100 [mel-47(3245 bp rescuing fragment) + rol-6(su1006)]. Maintain by picking Rollers. Animals which have lost the transgene look wt but are fully penetrant Mel. Mutant embryos arrest with less than 100 cells.

ytEx209 contains [mel-46(+) + sur-5::GFP]. Maintain by picking GFP+. Culture at 20°C or higher in order not to lose the transgene. GFP minus worms are Mel or sterile at 25 C (completely penetrant). Strong but not fully penetrant Mel at 15 C. To start a yt5 homozygous culture transfer several GFP minus worms to 15°C.

ytEx211 contains [pRM8(mel-46+) + pTG96(sur-5::GFP)]. Larval lethal. GFP minus worms die or arrest as L4 larvae.

Small brood size, reduced adult length, reduced locomotion and reduced life span. Maintain at 25°C. Unable to grow at 15°C. Withered tail-tip phenotype at 20°C and 25°C. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

Superficially wild-type. Slight decrease in brood size and locomotion speed. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.

sa580 is a G-to-A transition that changes a glycine at position 965 to a glutamate in MIG-6. Reference: Jafari M, et al. (2010) Genetics 186:969-982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.

This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093

This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093

egl-9(et60) is a 1670G>A (Arg557His) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.

egl-9(et62) is a 1669C>T (Arg557Cys) substitution and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.

ftn-2(et67) is a 267G>A (Trp89*) nonsense mutation and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.

ftn-2(et68) is a 409C>T (Gln137*) nonsense mutation and fat-2(wa17) suppressor. Reference: Kaper D, et al. Elife. 2025 Jul 8:13:RP104181. doi: 10.7554/eLife.104181. PMID: 40627529.

Reference: Ohta H, et al. Genetics. 2008 Oct;180(2):785-96.

Caenorhabditis sp. 15 Isolated in Kaui (Hawaii) from unidentified wild rotten fruit.

Male/Female, maintain by mating. Isofemale line isolated from rotting pwuhr fruit (Fagraea berteroana) in Kitti, Pohnpei, Micronesia (N 6.9066, E 158.1817), December 2023. Gonochoristic species in the Elegans Group (sister to C. kamaaina + C. oiwi). Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting breadfruit flowers in Kitti, Pohnpei, Micronesia (N 6.8632, E 158.1765), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting Citrus aurantifolia in Kitti, Pohnpei, Micronesia (N 6.8652, E 158.173), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from a rotting fruit at the Botanical Garden in Kolonia, Pohnpei, Micronesia (), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Male/Female, maintain by mating. Isofemale line isolated from rotting kotop (Clinostigma ponapensis) fruit in Kitti, Pohnpei, Micronesia (N 6.8577, E 158.2156), December 2023. Gonochoristic species in the Japonica Group. Reference: Rockman M, et al. 2024. New species from Pohnpei, Micronesia. In preparation.

Isolated by Annalise Paaby from an orange peel collected beneath a fig tree on State Street, Santa Barbara, CA (34.421629, -119.702021) in July 2010.

Isofemale line. Isolated by M. Rockman from a rotting palm fruit (?) on the Snyder-Molino trail on Barro Colorado Island, Panama (9°09.656' N, 79°50.490'W) on 4/24/12. Previously known as Caenorhabditis sp. 28.

Isofemale line. Isolated by M. Rockman from a rotten Gustavia superba flower on Barro Colorado Island, Panama (9°09.222'N, 79°49.564'W) on 4/25/12. Previously known as Caenorhabditis sp. 29.

xkIs99 [wrt-2p::rde-1::unc-54 3'UTR]. NOTE: This strain was originally published as JM43 in Melo JA, Ruvkun G. Reference: Melo JA, Ruvkun G. Cell. 2012 Apr 13;149(2):452-66.

Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.

Gin is Glucose INtolerant. gin-1(cv10) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. Grown on HB101, HT115 or fresh OP50 (seeded less than five days)