Search Strains

C33A11.4/tag-97. Homozygous. Outer Left Sequence: GTTTATAGTCTGGTCTCACACAAGG. Outer Right Sequence: AATCGTCTGGTGTCTGTTTGACC. Inner Left Sequence: TACGAGCTGCACCAGATCTCG. Inner Right Sequence: TTACAGATTCTTCGTGAGACC. Inner primer WT PCR product: 3537. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08C7.6. Homozygous. Outer Left Sequence: CTTATGCAGAGCATCACGGA. Outer Right Sequence: GCATATTTTAGCCATGCCGT. Inner Left Sequence: ATGGCGTTCTTGTCTGCTCT. Inner Right Sequence: AATTTTCCAATTTTTCGGGC. Inner primer WT PCR product: 2965. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07D3.7. Homozygous. Outer Left Sequence: tctgagtttggctcgatgtg. Outer Right Sequence: atgttccttggataccagcg. Inner Left Sequence: agcccagaactgggaaactt. Inner Right Sequence: aagtcgaattccgttggatg. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16H11.3. Homozygous. Outer Left Sequence: atcggcaaaggattcatcag. Outer Right Sequence: ttcttgtctggctgcctttt. Inner Left Sequence: tccattgtggctatgagctg. Inner Right Sequence: gatcgaacacctatgccgtt. Inner primer WT PCR product: 3216. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53D5.5. Homozygous. Outer Left Sequence: ccagcttctagccgcataac. Outer Right Sequence: caggtctcgaaacgaccaat. Inner Left Sequence: cccgtttttcagctttgtgt. Inner Right Sequence: acgggcaatattttcggaat. Inner primer WT PCR product: 2904. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04A9.4. Homozygous. Outer Left Sequence: AAACATTCGTTCATTTCCGC. Outer Right Sequence: GCACAGCAGCGATGTAAAAA. Inner Left Sequence: ATTTAAGTGGCTGGTGTGGC. Inner Right Sequence: CGTTTTGCCAATCGAATTTT. Inner primer WT PCR product: 2315. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs54 V. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

C04G6.1 Homozygous. Outer Left Sequence: ACCCGTCATTTCTGAAAACG. Outer Right Sequence: GCCAACCTGGTGTCGTAGTT. Inner Left Sequence: GACGTGCTTTGTGCGAATTA. Inner Right Sequence: CACTTGAGCTCCCTCGAATC. Inner Primer PCR Length: 2564. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28F9.1. 7/03: Not homozygous (Mark Edgley). Outer Left Sequence: CTCCTCCCTGTCTCTCGTTG. Outer Right Sequence: TGAAGGAAAAAGCGAAGCAT. Inner Left Sequence: TGGCGAGGAAATTAAGTTGG. Inner Right Sequence: AGACGTTTATTGGCACAGCC. Inner primer WT PCR product: 2791. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03G6.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC317.3. Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Primer PCR Length: 2747 bp. Deletion Size: 1258 bp. Deletion left flank: GCGATTTTTGTGCTTGGCGTCAAAAATGAT. Deletion right flank: AAATGCATCGGACATGACAAAACCATCGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C7.7d. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs56 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

M01D7.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs57 X. Pharyngeal GFP element integrated near unc-3 Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

okIs58 III. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

ZK1307.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

EEED8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B7.6 Homozygous. Outer Left Sequence: cgaatctcctccacggaata. Outer Right Sequence: atcgatttgatggtacggga. Inner Left Sequence: tggaatggattctggtggat. Inner Right Sequence: gagttgggctgtatggagga. Inner Length: 2972. Estimated Deletion Size: 2272. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05E4.1. Homozygous. Outer Left Sequence: CTTACTGCCGCAAATCTTCGCGA . Outer Right Sequence: GTTGCGTAGAACTTTCGAGCCTA. Inner Left Sequence: CACTTTATGACGGCACAAAAAAG. Inner Right Sequence: GTGTTATTCTAATTGTCTCGGAAC. Inner primer WT PCR product: 2719. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09D8.1a. Homozygous. Outer Left Sequence: gcattttgtttgccctgttt. Outer Right Sequence: tgcaatcgttttggaaatca. Inner Left Sequence: cctcctcgtatcctcgttca. Inner Right Sequence: tctccctgtcctctatccga. Inner primer WT PCR product: 2578. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43F9.6. Homozygous. Outer Left Sequence: cggtgctgcattgtgtctat. Outer Right Sequence: tcgtactgcttgtttgcgtc. Inner Left Sequence: aaatcgttcgaaattgtggg. Inner Right Sequence: tctcgacagacggtgagttg. Inner primer WT PCR product: 2548. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07G6.2. Homozygous. Outer Left Sequence: tgcgctgtttagaattgtgc. Outer Right Sequence: ctcattgggcaaagtctggt. Inner Left Sequence: tgcgcagtgttccaataaag. Inner Right Sequence: atccgaaccattgactgagg. Inner primer WT PCR product: 2748. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22A3.1 Homozygous. Outer Left Sequence: CACATCCGATGGATATGCCATGC. Outer Right Sequence: AATGTCGATATATTTGATGTGTTGGC. Inner Left Sequence: CCCATCGAGTATAACCGTCG. Inner Right Sequence: CATTGCGATTCCCATGTAACC. Inner Primer PCR Product: 3203. Estimated Deletion Size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35G12.3A. Homozygous. Outer Left Sequence: CACTGAGCAATTGCCTTTCA. Outer Right Sequence: ATCGCCGAAGGTAGGTTTTT. Inner Left Sequence: CAAACACATCATCCACCACC. Inner Right Sequence: TTTCTTCCAGGTGGATTTGC. Inner primer WT PCR product: 3269. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38A6.2. Homozygous. Outer Left Sequence: CTTGTCTCGTCCCTGAAAGC. Outer Right Sequence: GCTCGCTTTCCTATTCAACG. Inner Left Sequence: TTGCCAATTCCAAACAGACA. Inner Right Sequence: ATTATATCCGACGTGCTGCC. Inner primer WT PCR product: 3036. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.6. Homozygous. Outer Left Sequence: tgtaccaccgtgaggaaaca. Outer Right Sequence: atgcacacattacccccatt. Inner Left Sequence: gcgactcattcagcatcaga. Inner Right Sequence: tggcataggtcctggcttag. Inner primer WT PCR product: 2405. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55H12.1. Homozygous. Outer Left Sequence: CTCCCTACCACGCATTGTTT. Outer Right Sequence: CCACTCCGTCACCCACTACT. Inner Left Sequence: TTGAACGTGGACTTTTCGTG. Inner Right Sequence: TGATATTCGCTCGCAGTGAC. Inner primer WT PCR product: 3669. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F10.1. Homozygous. Anion exchange protein. Outer Left Sequence: attgtgattgcaccaagcag. Outer Right Sequence: aatcaatgagacgcggaatc. Inner Left Sequence: tggtgatggcacaaagtgtt. Inner Right Sequence: tcgatgaatggatacggtga. Inner primer WT PCR product: 2831. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F4.8. Homozygous. Outer Left Sequence: atgctgggtgaaactaacgg. Outer Right Sequence: caaaagcatcgcagaaaaca. Inner Left Sequence: ctggaagttgtccagatggc. Inner Right Sequence: tccggtgtgaaatgtaacga. Inner primer WT PCR product: 2582. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.5. Homozygous. Outer Left Sequence: ACTGAAATGGGTGCTGCTCT. Outer Right Sequence: CAAATGTTGAGTCTTGCCGA. Inner Left Sequence: TGATAGTTCCGCCAACAACA. Inner Right Sequence: ACGCAGCCTTCTCAACTGAT. Inner primer WT PCR product: 2985. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK637.11. Homozygous. Strain grows better at 15 degrees. Outer Left Sequence: GTTCCTTCTCTAATCCCCGC . Outer Right Sequence: GTTTTTGATTCGCAGGTGGT. Inner Left Sequence: GTTTTCTGTCCACTTCCCGA. Inner Right Sequence: CCCACAATGAGACGAGTGTG . Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK829.10. Homozygous. Outer Left Sequence: CACGTGTAAGCTCGACTCCA. Outer Right Sequence: ACATTGAACAATGCGGAACA. Inner Left Sequence: GGCCCACTCTTTAATACGCA. Inner Right Sequence: GAACTTGCCCCCACATCTAA. Inner primer WT PCR product: 3546. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0240.1. Homozygous. Outer Left Sequence: CCCGTTTTACCAATCCCTTT. Outer Right Sequence: ATGACACACGACGGACAAAA. Inner Left Sequence: CGAAAGCGAGACTTTCCGTA. Inner Right Sequence: TAACTGCAAGAAAATCGGGG. Inner primer WT PCR product: 3086. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0273.2. Homozygous. Outer Left Sequence: cagattttgagccaagctcc. Outer Right Sequence: gtgaacttctcgaagacggc. Inner Left Sequence: aatcattttcccgtccgttt. Inner Right Sequence: tccagtggatagttggcct. Inner primer WT PCR product: 3185. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04G7.3. Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner primer WT PCR product: 2730. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46G10.3. Homozygous. Outer Left Sequence: cgcaccatattgctttgatg. Outer Right Sequence: gcatatgctgctgctgctaa. Inner Left Sequence: actctctcgcctgtgtcaaat. Inner Right Sequence: cgaagcgcttatcacctttc. Inner primer WT PCR product: 2267. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08D2.7. Homozygous. Outer Left Sequence: ataagacggcgttccacagt. Outer Right Sequence: acttggcgcgttagatgact. Inner Left Sequence: atgcaccgctcagctttatt. Inner Right Sequence: tcgatagagacctccggttg. Inner primer WT PCR product: 2905. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21G5.3. Homozygous. Outer Left Sequence: agtgcatttggaggatcagg. Outer Right Sequence: aaagagtttgcgcgtcattt. Inner Left Sequence: cgatcgagtgactgtccaga. Inner Right Sequence: ttcaattgcagacttcgtcg. Inner primer WT PCR product: 2952. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27H5.8. Homozygous. Outer Left Sequence: tcagcaccttcactgattgc. Outer Right Sequence: ttcccgaccactaggtatgc. Inner Left Sequence: cgacacattgtacagacccg. Inner Right Sequence: gcacctccaccacaggttat. Inner primer WT PCR product: 3279. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54A12.4. Homozygous. Outer Left Sequence: tcatccttcggcataccttc. Outer Right Sequence: atttcccactggttgcactc. Inner Left Sequence: tccgtggtggttattggatt. Inner Right Sequence: gaaaccggtcacaagttcgt. Inner primer WT PCR product: 2628. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53H8.2. Homozygous. Outer Left Sequence: agttttatgccgctctcgaa. Outer Right Sequence: tcaattcgttccccactctc. Inner Left Sequence: caacttttccgccacataca. Inner Right Sequence: atggcggaagtttaccctct. Inner primer WT PCR product: 2402. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y1A5A.1. Homozygous. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A5.1A. Homozygous. Outer Left Sequence: cgatatgccgaagaacaaca. Outer Right Sequence: caacagaaactcgtgctcca. Inner Left Sequence: tggaagtgctctccgagttt. Inner Right Sequence: tttcccttcacatcgagacc. Inner primer WT PCR product: 2880. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13G3.4. Homozygous. Outer Left Sequence: TTTCGTATTTCCAACTCCCG. Outer Right Sequence: CAACTGGATCCCCATTTGAC. Inner Left Sequence: TGATCCAATCAGCGACTTTG. Inner Right Sequence: CGATTTATCTGCATGCCTCA. Inner primer WT PCR product: 2157. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13G3.3, F13G3.4. Homozygous. Outer Left Sequence: TTTCGTATTTCCAACTCCCG. Outer Right Sequence: CAACTGGATCCCCATTTGAC. Inner Left Sequence: TGATCCAATCAGCGACTTTG. Inner Right Sequence: CGATTTATCTGCATGCCTCA. Inner primer WT PCR product: 2157. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A8.5. [NOTE (10/28/11): Possible heterozygous strain; genotype being confirmed by Moerman Lab] Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807