Search Strains

C15H11.2 Homozygous. Outer Left Sequence: tcgtttcgagaccgagtacc. Outer Right Sequence: caccatttggagtgacgttg. Inner Left Sequence: tgggtccaaaattgccagt. Inner Right Sequence: atctatgagcgaatcgtcgg. Inner Primer PCR Length: 1231. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A6.2 Homozygous. Outer Left Sequence: actaacaaatggggcagcac. Outer Right Sequence: gcgagctttgaacttttgct. Inner Left Sequence: caaaaatgttgctcccatca. Inner Right Sequence: ttttctttcagttcagcccc. Inner Primer PCR Length: 1196. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46H5.3 Homozygous. Outer Left Sequence: ggctcagcactttgtttgtg. Outer Right Sequence: cttcaagccactcttcgacc. Inner Left Sequence: gagaaagtaggtatacacaggagcg. Inner Right Sequence: tccaggtatcgatttgcctc. Inner Primer PCR Length: 1362. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08E3.4 Homozygous. Outer Left Sequence: caacttgagacatggtgcgt. Outer Right Sequence: atgtctgttgctctttgcca. Inner Left Sequence: gccaagaccacattgagaca. Inner Right Sequence: tctctacgaagttctcgacaaaaa. Inner Primer PCR Length: 1155. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22A3.2 Homozygous. Outer Left Sequence: ttgaaaatgtttcttcgggg. Outer Right Sequence: aattacaactgactcggcgg. Inner Left Sequence: tgccagaaacttccagttca. Inner Right Sequence: gccccttcagcataacgat. Inner Primer PCR Length: 1319. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01G12.14 Homozygous. Outer Left Sequence: aaccgattcctcatccctct. Outer Right Sequence: aggggtcacacacagacaca. Inner Left Sequence: ccacctggatctttcaccat. Inner Right Sequence: ttgattgaacgctgtgaagg. Inner Primer PCR Length: 1305. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.1 Homozygous. Outer Left Sequence: gtggacatcccacgtcttct. Outer Right Sequence: ttgctcctgggatagtacgg. Inner Left Sequence: aagtacgatgtcgcagagcc. Inner Right Sequence: caattgagactccgacgtga. Inner Primer PCR Length: 1147. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54F6.14 Homozygous. Outer Left Sequence: atgtgtctcagatttccgcc. Outer Right Sequence: gaaccctttcgttgccaata. Inner Left Sequence: ggttgaacctttttaggaactgc. Inner Right Sequence: acagtcccggacacgtaatc. Inner Primer PCR Length: 1178. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02G9.4 Homozygous. Outer Left Sequence: taccctgacattatccccca. Outer Right Sequence: ctaggtttcagatcgcctgc. Inner Left Sequence: ccaacccaattcctcttcaa. Inner Right Sequence: ccttagtccgctttaggtcg. Inner Primer PCR Length: 1094. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32D1.4 Homozygous. Outer Left Sequence: atatgccaagcaaatctggc. Outer Right Sequence: gaaatttgtcggattcaccg. Inner Left Sequence: aaatcgaattggctgcagat. Inner Right Sequence: ccagtttcagtcgttcccat. Inner Primer PCR Length: 1107. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12E12.6 Homozygous. Outer Left Sequence: agatgagaaacggagagcca. Outer Right Sequence: ggggatttcttcgaatcaga. Inner Left Sequence: cgtacaacttgagcaaaaagtga. Inner Right Sequence: tgttttacccacgtaaaatgga. Inner Primer PCR Length: 1203. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

AC3.2 Homozygous. Outer Left Sequence: cgtgtgatggtgacaagacc. Outer Right Sequence: agaacagcaacgaacacgaa. Inner Left Sequence: acgtggcattcagtgaacaa. Inner Right Sequence: ggacaaaagcaataacatcaaga. Inner Primer PCR Length: 1279. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03C11.3 Homozygous. Outer Left Sequence: aggtgctgttgagtcctgct. Outer Right Sequence: ttctctcctcgtccacgact. Inner Left Sequence: aaattccacaaaatccgctg. Inner Right Sequence: ccgggaacatccaaactg. Inner Primer PCR Length: 1090. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y62E10A.12 Homozygous. Outer Left Sequence: actatgtgagccctgaacgg. Outer Right Sequence: gagatttttcaaacggcgaa. Inner Left Sequence: ggctggaaagtgaattgagc. Inner Right Sequence: cagccatgtgtcgatttatga. Inner Primer PCR Length: 1360. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F12.5 Homozygous. Outer Left Sequence: aaacgattccatccttgcag. Outer Right Sequence: aactggatgaggatgttccg. Inner Left Sequence: tcggacatatttccacattctc. Inner Right Sequence: gaagcacaatcattcgggat. Inner Primer PCR Length: 1234. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14B9.1 Homozygous. Outer Left Sequence: tttcaggtccacaacaccaa. Outer Right Sequence: aaaatcatccctcgatgtgc. Inner Left Sequence: agttcgaggtcggacttgac. Inner Right Sequence: cattattcgtgcgttgatgc. Inner Primer PCR Length: 1096. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H06O01.2 Homozygous. Outer Left Sequence: gggaagattggggaaaagaa. Outer Right Sequence: tgcacaaaaagcttgaacca. Inner Left Sequence: catcgaaaactttcggaatga. Inner Right Sequence: ggctcaccagaagcagtttt. Inner Primer PCR Length: 1197. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55B1BR.2 Homozygous. Outer Left Sequence: gtggcgtcagagtgtctcaa. Outer Right Sequence: taatcctaaggcaaagccca. Inner Left Sequence: ggtggagagacgcagagttc. Inner Right Sequence: ccaaagcctaagcctgagc. Inner Primer PCR Length: 1323. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E10.8 Homozygous. Outer Left Sequence: gcatcacatggaagccctat. Outer Right Sequence: tcccgaagatgaccacaaat. Inner Left Sequence: tccgcaagtttccagaaaag. Inner Right Sequence: atacgcgccacaaatcaact. Inner Primer PCR Length: 1249. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40D4.1 Homozygous. Outer Left Sequence: gcaattcattccgctctttc. Outer Right Sequence: tagtcgagcacatgagtggc. Inner Left Sequence: cggacagcagaagctcactt. Inner Right Sequence: acgatacggtgtatgcacga. Inner Primer PCR Length: 1133. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6G.2 Homozygous. Outer Left Sequence: cccatacgtactcggagcat. Outer Right Sequence: aatagctctgcaccggaaga. Inner Left Sequence: cttccagcacgaagaagcat. Inner Right Sequence: tgcaacgagaagatcgagtg. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27E9.4 Homozygous. Outer Left Sequence: gaatgttcgcatctgacgtg. Outer Right Sequence: cgcagcgacatacacttgtt. Inner Left Sequence: attgcgaaaatccccctcta. Inner Right Sequence: aatctttaaaggcgcacacg. Inner Primer PCR Length: 1148. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01A2.11 Homozygous. Outer Left Sequence: ccgtccaaatcgaattccta. Outer Right Sequence: agacgaagagttcggggaat. Inner Left Sequence: tcccagctatgggagcttta. Inner Right Sequence: taccatgtcacgcgatgttt. Inner Primer PCR Length: 1123. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A12.4 Homozygous. Outer Left Sequence: tcgccttgtttactgcctct. Outer Right Sequence: cgctactgcgaacgagtttt. Inner Left Sequence: ctggttggcagttttccagt. Inner Right Sequence: aaacgtttttgttccctttgaa. Inner Primer PCR Length: 1277. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39B2.7 Homozygous. Outer Left Sequence: acgttttgacagaaatcggg. Outer Right Sequence: tgacgtcattgaggcagaag. Inner Left Sequence: ggcactggaaaagagacaaga. Inner Right Sequence: acgtgctcaaaaacgaatcc. Inner Primer PCR Length: 1228. Estimated Deletion Size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.12 Homozygous. Outer Left Sequence: cattgtgtccaaagtgtccg. Outer Right Sequence: ctgatttctggctctacggg. Inner Left Sequence: gcggttggttcataaattgg. Inner Right Sequence: ggtgagatcacctcgaaagc. Inner Primer PCR Length: 1118. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F12.7 Homozygous. Outer Left Sequence: aggcaaaccataagcctgaa. Outer Right Sequence: catctttgattttcccgcat. Inner Left Sequence: tggtttttgcattttcaacc. Inner Right Sequence: aaaacactggatccgcattg. Inner Primer PCR Length: 1232. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03A10.6 Homozygous. Outer Left Sequence: gtcggacgcacagctaagtt. Outer Right Sequence: ggccccaaactacaaacaaa. Inner Left Sequence: gtccgacaatttttgggttc. Inner Right Sequence: aagcatgctccttcttctcg. Inner Primer PCR Length: 1179. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B3B.2 Homozygous. Outer Left Sequence: tgaaaacgtgctcgtacacc. Outer Right Sequence: atgactacggtagatggcgg. Inner Left Sequence: tcgtgcaaagtttgagcatt. Inner Right Sequence: ggaccgaaacatttttgcat. Inner Primer PCR Length: 1130. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs46 I. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

T08A9.3. Homozygous. Outer Left Sequence: AATTTCCAACGACGTTTTCG. Outer Right Sequence: ATGGGTTTGATGGTGGTTGT. Inner Left Sequence: AATGCATGCCCTGTACATCA. Inner Right Sequence: GCAGCACCAGATTGGTATGA. Inner primer WT PCR product: 3359. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D7.3 Homozygous. Outer Left Sequence: CATAATCCCCTGAACCCCTT. Outer Right Sequence: CACCTGCTAACATTCGCTGA. Inner Left Sequence: TCAATCAGTGCACCTTTTCG. Inner Right Sequence: CGAATATCCTTCGGAATCCA. Inner Primer PCR Length: 3269. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs47 X. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

T05A7.11, T05A7.10. Homozygous. Outer Left Sequence: CAACATGTTCGGGAGTGATG. Outer Right Sequence: GCCACTCCATTTTTCGATGT. Inner Left Sequence: ACAGCAATGTCAAGCATTCG. Inner Right Sequence: ACGGGATATCAATGAGACGG. Inner Primer PCR Length: 3185 bp. Deletion Size: 1882 bp. Deletion left flank: TCGTAACTCCTTCATCATCTGGTTTCAAAT. Deletion right flank: ATGGAATATCATATCGTCGATTTTTATTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2030.5 Homozygous. Outer Left Sequence: gcttcaacttccactgctcc. Outer Right Sequence: tctcaagcacattggtctcg. Inner Left Sequence: ccaagtagccttcatctcgc. Inner Right Sequence: cccatgtgcgtaaggaattt. Inner Length: 3121. Estimated Deletion Size: 1621. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C31C9.1. Homozygous. Outer Left Sequence: AATGTGCTAATCCGCAAACC. Outer Right Sequence: TAATCATTTTCCAGCCCTCG. Inner Left Sequence: CCTGGGATATTTTCGCAGAC. Inner Right Sequence: CGATCATCCACTCGTCATTG. Inner primer WT PCR product: 2333. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03D7.7. Homozygous. Outer Left Sequence: CAACTTCTTGAAGGCTTCGG. Outer Right Sequence: TGTCTTGCGTTGATTTGCTC. Inner Left Sequence: CTTGGCTATTGCCCAACATT. Inner Right Sequence: TTGAGGGAATTCAAACAGGG. Inner primer WT PCR product: 3076. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18G1.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C55C3.3. Homozygous. Outer Left Sequence: tgaatcggaaaaatcgaagg. Outer Right Sequence: gatctaccaagaatgcggga. Inner Left Sequence: caggtctcgccacgatttat. Inner Right Sequence: tttgtctgggcgaaaaattc. Inner primer WT PCR product: 3283. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33D9.1a. Homozygous. Outer Left Sequence: taccttttggttgtgtgcca. Outer Right Sequence: caattaccgtcccaaccatc. Inner Left Sequence: ccaatagttgcggaaggaaa. Inner Right Sequence: attggactttgatgcggttc. Inner primer WT PCR product: 3388. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y110A7A.10. Homozygous. Outer Left Sequence: GGACTCCGAGCTACTCAACG. Outer Right Sequence: ATGGGGGACAAGTGGATGTA. Inner Left Sequence: AATGAGCTTGTCGAGGAGGA. Inner Right Sequence: GGAGATGGAGAATCCCATGA. Inner primer WT PCR product: 2661. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F4.2. Homozygous. Outer Left Sequence: GTGTGTGTGCAAAATGGAGG. Outer Right Sequence: ATAGTCCAAGCCACAAACCG. Inner Left Sequence: ATTGAAGGTTCGCTTGTTGG. Inner Right Sequence: AGCTCGTAGCTGAGCGTTTC. Inner primer WT PCR product: 3219. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D6.3. Homozygous. Outer Left Sequence: GATGCCGGAAAAAGATGAAA. Outer Right Sequence: GTTATCATCCAGCAAATACACC. Inner Left Sequence: GTTGCACAATACGTATGTATTCTC. Inner Right Sequence: CTTTGGTGTTAGTTGCAGGAG. Inner primer WT PCR product: 1526. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs52 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

F53F4.5. Homozygous. Outer Left Sequence: GCATATGGTACATTTGCCCC. Outer Right Sequence: AAATCAACTCAAACCGCACC. Inner Left Sequence: GCTTCATTGGCGGTAAACAT. Inner Right Sequence: CTCCTCCTCCTCCTTCTCGT. Inner primer WT PCR product: 2475. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07D1.1. Homozygous. Outer Left Sequence: ctacgacaattgcgggagat. Outer Right Sequence: aggcttaggcaaggcttagg. Inner Left Sequence: aaaatttccgcattttgtgg. Inner Right Sequence: ggcctaaaacattggcttga. Inner primer WT PCR product: 3072. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A11.4/tag-97. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807