| VC2928 |
C. elegans |
C35D6.4(gk1282) IV. Show Description
This strain is homozygous for a deletion (gk1282) in C35D6.4, detectable by PCR using the following primers. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: AGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Validation: gk1282 passed by CGH with low log2 scores. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2929 |
C. elegans |
F56H6.6(gk3146) I; Y38F1A.1(gk1246) II. Show Description
Y38F1A.1, F56H6.6. The gk1246 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACCCCATTGTTGAACTTT. External right primer: ATGCCACGTAGCAAAAATCC. Internal left primer: TTCCCAAACACAAGAATCCC. Internal right primer: GCTAAGAGATATCGCGCGTC. Internal WT amplicon: 1616 bp. Deletion size: 617 bp. Deletion left flank: GCTCGACAGGGTTGACATGCCAGAACGCGT. Deletion right flank: TCCCGGTGATTGTAAGGTCTTTAGACATAT. The gk3146 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2930 |
C. elegans |
C40D2.4(gk1258) II; sru-36(gk3145) V. Show Description
R07B5.6, C40D2.4. The gk1258 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 942 bp. Deletion left flank: ATGAGTGATTTACTTTTAAAACTTGAAAAT. Deletion right flank: ATATGTATATGTATATGTATATGTATATGT. The gk3145 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2931 |
C. elegans |
coel-1(gk1284) X. Show Description
C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 182 bp. Deletion left flank: ATCATACCGAACTGCGGTCCTGCTGCCTGT. Deletion right flank: GCCAGAGAGCCCTAGAACTTCTTGTGCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2932 |
C. elegans |
coel-1(gk1274) X. Show Description
C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 268 bp. Deletion left flank: TCCCACCGGACGGCGCACGCAACAGCCCGT. Deletion right flank: TTTGAAATTCAAACTGATCTTCTAACAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2933 |
C. elegans |
C35D6.4(gk1281) IV. Show Description
C35D6.4. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: TGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2934 |
C. elegans |
F38C2.7(gk1244) IV. Show Description
F38C2.7. External left primer: TGCTCCAGTGTGCACAAAAT. External right primer: TTCACAGAGAGTGTGGCCTG. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: TGTTGAAGCAAGCAACCAAG. Internal WT amplicon: 598 bp. Deletion size: 392 bp. Deletion left flank: CACCTGATTCCGTACTTGCAATGCCCAGTT. Deletion right flank: TTCTTGGTTGCTTGCTTCAACAGACATTGT. Insertion Sequence: CTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2935 |
C. elegans |
gcy-27(gk1267) IV. Show Description
C06A12.4. External left primer: CTTCCGAAAAAGCTGTGGAG. External right primer: TCGGTTTTAGGTGCAGCTTT. Internal left primer: TTGCAATTGCGTTTCGTAGA. Internal right primer: TGCATTGATACCTTTCGCTG. Internal WT amplicon: 2701 bp. Deletion size: 1198 bp. Deletion left flank: TTGTGACCCCATATAATGCAATTTTCAGTA. Deletion right flank: CCGATACTTGATGAGTATGTTCACAACTAC. Insertion Sequence: GGTGACACTGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2936 |
C. elegans |
kin-26(gk1261) IV. Show Description
T06C10.6. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 783 bp. Deletion left flank: CGGCTTGATCTGATAAACAGTTCCATTTCG. Deletion right flank: GATTGACTAGCATACAACCTTCTTTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2939 |
C. elegans |
Y39A1C.1(gk1241) III. Show Description
Y39A1C.1. External left primer: GGTAATGCCGTCTGGAAATG. External right primer: CTGCGTCTCCTCCTCTTCAC. Internal left primer: CCATTCCCTGAAGTTGCAGT. Internal right primer: TGAGCCAGTATGACGTGAGC. Internal WT amplicon: 935 bp. Deletion size: 413 bp. Deletion left flank: CACAGAAACGTGGAATTTCTCTCCCCAGTC. Deletion right flank: GATTTTTCAAGCAATTTTCAGTAGAAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2975 |
C. elegans |
bath-5(gk3138) II; Y41D4B.26(gk1259) IV; unc-83(gk3139) V. Show Description
W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2982 |
C. elegans |
gkDf24 I; ikke-1(gk1264) III. Show Description
F11A6.1, W04G5.6, T22H2.1, T22H2.6, F11A6.2, T22H2.5, T22H2.3, R107.4, T22H2.2, W04G5.5, W04G5.10, W04G5.1, W04G5.15, W04G5.9, W04G5.12, W04G5.13, W04G5.11, W04G5.8, W04G5.7, W04G5.14, F11A6.8, F11A6.11, F11A6.5, F11A6.9, F11A6.13, F11A6.4, F11A6.10, F11A6.14, F11A6.6, F11A6.7, F11A6.12, T22H2.4, T22H2.7. The gk1264 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ATTCTCGCAACAAATCCGAC. External right primer: CAATCGTCATTACACACGGC. Internal left primer: GCTCCGGTTTAGGGAATTGT. Internal right primer: AGTAGCAGTTTGGAAGCGGA. Internal WT amplicon: 2692 bp. Deletion size: 722 bp. Deletion left flank: TGAAGGTTCATGGAAAAAGCTGCGTAGAAG. Deletion right flank: TGCATTTGATGAAAGTCCTCTGTGATTCTT. The gkDf24 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3004 |
C. elegans |
F59E12.3(gk1277) II; srxa-9(gk3141) X. Show Description
ZK678.4, F59E12.3. The gk1277 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 588 bp. Deletion left flank: AGGCAATAAATGTTCATTATCGACTGCCAT. Deletion right flank: ATCGATGGACTAAGCTTCTTTGAGGAGCCA. The gk3141 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3007 |
C. elegans |
F53H4.5(gk1273) X. Show Description
F53H4.5. External left primer: CTTCCGTCTTAATTTTTGCACC. External right primer: GCAATATCATCGGCTAATGTCA. Internal left primer: GGGCATAGTTTAAGTCACGTCC. Internal right primer: TTTTTCCAAAACGCTCAAAAAT. Internal WT amplicon: 1259 bp. Deletion size: 430 bp. Deletion left flank: CCAATCAGTGCTCCGCTAAGTGTCAGAGCA. Deletion right flank: ATGTAGATCAGAGCTGTGCAGCAGCCGAGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3008 |
C. elegans |
T06G6.5(gk1278) I. Show Description
T06G6.5. External left primer: GCAACCTCTACCGTAACCCA. External right primer: GGGCATATACTCTGGCGAAA. Internal left primer: TTCGCACATATCTGTTGGTTTC. Internal right primer: ATGGGTACATTTTTGGAACTGG. Internal WT amplicon: 1372 bp. Deletion size: 1128 bp. Deletion left flank: ATATCTGTTGGTTTCCATATTTCGAAAATG. Deletion right flank: CCACTTACCATGTAAACACATCTACTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3011 |
C. elegans |
gkDf21 I; Y53F4B.1(gk1289) II. Show Description
This strain is homozygous for a deletion (gk1289) in Y53F4B.1, detectable by PCR using the following primers. External left primer: GCACTTCAAACGCAGATTCA. External right primer: GTTGTGGCTGCTCTGAACAA. Internal left primer: GCTGCTGACGTCACACTGAT. Internal right primer: TATTGGTGAAAGAGAGGCCG. Internal WT amplicon: 2011 bp. Deletion size: 862 bp. Deletion left flank: AATAGAAGGTAGGCAGGCACGTAGGCAGCG. Deletion right flank: AATTTGCCGTTTGCCAGAAATGTTTTTTTT. Validation: gk1289 passed by CGH. Other deletion (gkDf21) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3016 |
C. elegans |
ZK354.2(gk1288) F01G4.3(gk3110) IV. Show Description
This strain is homozygous for a deletion (gk1288) in ZK354.2, detectable by PCR using the following primers. External left primer: GCCTCCCCCTATCGATAAAC. External right primer: TCGTCTTGTTGTTCTTCCCC. Internal left primer: TGAACATGAAGAGCTCGGTG. Internal right primer: GTACCCGGGACCCTTGTAAT. Internal WT amplicon: 1294 bp. Deletion size: 770 bp. Deletion left flank: AACATGAAGAGCTCGGTGAGTTATTGATGG. Deletion right flank: CCAAGAAAAACGATGAAGCTGAGGAGCAGA. Validation: gk1288 passed by CGH. Other deletion (gk3110) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3033 |
C. elegans |
coel-1(gk1291) X. Show Description
This strain is homozygous for a deletion (gk1291) in C52B9.3, detectable by PCR using the following primers. External left primer: ACATTTTTGTGGCCTTTTCG. External right primer: ATTCCCTTCTCATCCCTGCT. Internal left primer: TTTTCACTTGTCCCTCGACTTT. Internal right primer: TCGTTGAATGTATTTGCAGGTC. Internal WT amplicon: 1349 bp. Deletion size: 873 bp. Deletion left flank: TGGTGATGGGTTTTTAAAGTAACTTTTCAG. Deletion right flank: GTAAACTTAAGCCGTAATTGACACTCTAAT. Validation: CGH diagnostic for gk1291 equivocal. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3139 |
C. elegans |
Y53C12B.1(ok1245)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Y53C12B.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1245 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCTGCTAGTGGCCATGTTT. External right primer: GAAATGGGTGGGCACTTAAA. Internal left primer: GCTAACATCTTGCTTTGCCC. Internal right primer: CGCGTAGAATTAAACGGGAA. Internal WT amplicon: 3125 bp. Deletion size: 1458 bp. Deletion left flank: CAGTATGCGCATCAATGGAACATTCACAAT. Deletion right flank: TTTCTTGAGTTTCTGTTTCATGAATACTCA. Insertion Sequence: TTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3151 |
C. elegans |
cpf-1(ok1220)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28C6.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1220 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTCCGAGTGAACTGGCT. External right primer: AGCACACATGCAGGTTGAAA. Internal left primer: CCATTTGAAGCAGCCAAGAT. Internal right primer: TACGATTTGAGGGGAGATCG. Internal WT amplicon: 2198 bp. Deletion size: 1785 bp. Deletion left flank: CTTTCTGTCGGAATTGCGAGCATCCCACGA. Deletion right flank: TTAAACTTATATTAAAGGCGCATGCCGTTT. Insertion Sequence: ACTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3167 |
C. elegans |
+/szT1 [lon-2(e678)] I; hlh-8(ok1248)/szT1 X. Show Description
C02B8.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1248 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCGCGGTAATTTTTCAAC. External right primer: GCATCAGACAGTGTGGAGGA. Internal left primer: CCTTTCTTTTCACCGAGCAG. Internal right primer: GAGGGGGAATATGTGCTGAA. Internal WT amplicon: 3385 bp. Deletion size: 2391 bp. Deletion left flank: GAGCATGTGCCAACAGACGGGAACGTCAAA. Deletion right flank: AACATGTTCATAAACTTAGCATTTTCCGCT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3272 |
C. elegans |
+/szT1 [lon-2(e678)] I; C35C5.6(ok1279)/szT1 X. Show Description
C35C5.6. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1279 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTCCGATGAGCACGTTAGG. External right primer: GCGAGAAGAGCATTTTGACC. Internal left primer: CCGTCAATCAGAGAAGAGCC. Internal right primer: CCTTCGACAATAAAGGCCAA. Internal WT amplicon: 3388 bp. Deletion size: 1808 bp. Deletion left flank: CTTGCAATATATTTGGGCTACACAATGAGT. Deletion right flank: CTTCATTCCAACCGGAACAATTCATATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3289 |
C. elegans |
sdhd-1&ilkp-2(ok1222) II. Show Description
Homozygous viable, carrying a deletion affecting sdhd-1 and ilkp-2. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3434 |
C. elegans |
pot-1(ok1292) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0280.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1292 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTCCGGTCTTCGTCTAC. External right primer: ACTTTCAGCTCCAGACGCTC. Internal left primer: CGCAGCAACATCATTCAAAC. Internal right primer: ATAGATTGAGCGCCGAGAAG. Internal WT amplicon: 2359 bp. Deletion size: 916 bp. Deletion left flank: CTCATCAAGTTGATCAGTTTGCTGAGTTCA. Deletion right flank: CCTGAATATTTTTTTTGAATCTAGTAACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3442 |
C. elegans |
B0495.2(gk1202)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
B0495.2. Homozygous maternal-effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1202 homozygotes (viable F1s produce few F2s that arrest as early or mid-stage larvae). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTATGAGCGACCACTTGGG. External right primer: CATTGAGGCAATTGAGAGCA. Internal left primer: GGACGACAGGAAAGATCTGG. Internal right primer: GGGTTTCACTTGCTCTGGTC. Internal WT amplicon: 2049 bp. Deletion size: 712 bp. Deletion left flank: GACAAATCGCCACACAAAAAGTCAAAACAT. Deletion right flank: GGAGAAAGAGAAAGAAGGATTTCCAATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC3465 |
C. elegans |
flp-22(gk1201) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F39H2.1. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1201 homozygotes (variable arrest, at least some animals persist to sterile adulthood). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGTTTCCTTTTGAGCAG. External right primer: ATCCACTTGGGTTTCGTTTG. Internal left primer: TTCCGGAAACCGCATATTAG. Internal right primer: TTACGCAATGCACACACTGA. Internal WT amplicon: 2028 bp. Deletion size: 471 bp. Deletion left flank: TCAGCAAAATGGATGAGATTTGGAAAGCGT. Deletion right flank: TTTTTGAAGATCAAAGCGAAATAAGACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4113 |
C. elegans |
K12C11.6(gk5190) I; sre-40(gk5191) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.
|
|
| VC4115 |
C. elegans |
K12C11.6(gk5190) abhd-11.1(gk5194) C01A2.6(gk5192) I; F25B5.3(gk5193) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.
|
|
| VC4118 |
C. elegans |
ZK1248.11(gk5197) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5197 mutation is G->A, flanking sequences AAATTGGATCCTTTCTACTATGTTGAACTT and CATCACTTCCATTTCATTTTCATCGTTTTT.
|
|
| VC4134 |
C. elegans |
ZK1225.1(gk5216) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA.
|
|
| VC4168 |
C. elegans |
ZK1251.3(gk5254[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 708 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGACTTTGTCAAACACGGAAAAACCATTA ; Right flanking sequence: GTTTGGTAGAGGAGAAAGAGTTCCATTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC432 |
C. elegans |
dapk-1(gk219) I. Show Description
K12C11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4659 |
C. elegans |
K12H4.3(gk5728[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1454 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTCTTCCATATTATTTTAAATTACAACCT. Right flanking sequence: TGGATCCGATTAATTTTTGTTGAATTTATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4761 |
C. elegans |
ZK1236.5(gk5829[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATTCGCTCAGTCCCATCGTTTTCTTGCCG. Right flanking sequence: CGGAGCGTCGTTGGAAATATTTTGGAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4833 |
C. elegans |
ZK1236.9(gk5901[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2713 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GCCTAAAATATTCGAAATAAAAGTTAAATA. Right flanking sequence: TGGGAATCAGAATAAAACGAGGAAACGACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC761 |
C. elegans |
aspm-1(ok1208) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C45G3.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1208 homozygotes (sterile, clear, often with vulval blip, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC764 |
C. elegans |
hat-1(ok1265) III. Show Description
M03C11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC769 |
C. elegans |
+/szT1 [lon-2(e678)] I; ifa-1(ok1257)/szT1 X. Show Description
F38B2.1a. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, lon-2 males, arrested szT1 aneuploids, and ok1257 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC770 |
C. elegans |
T07A9.14&ssna-1(ok1259) IV. Show Description
T07A9.11, T07A9.13. Viable, bloated with eggs, with vulval blip and tail abnormalities. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC772 |
C. elegans |
ZK1128.4&swsn-2.1(ok1200) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK1128.4, ZK1128.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1200 homozygotes (Dpyish, mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC778 |
C. elegans |
ifg-1(ok1211)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
M110.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1211 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC789 |
C. elegans |
mog-2(ok1221)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
H20J04.8. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok1221 homozygotes (viable, slow-growing and sometimes grotty, very slow to starve plate). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC810 |
C. elegans |
+/szT1 [lon-2(e678)] I; gakh-1(ok1284)/szT1 X. Show Description
F46G11.3/tag-257. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males (szT1 hemizygotes), and ok1284 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC814 |
C. elegans |
ero-1(ok1287)/unc-54(e190) I. Show Description
Y105E8B.8. Homozygous lethal deletion chromosome balanced by unc-54(e190). Heterozygotes are WT, and segregate WT, paralyzed Unc (unc-54 homozygotes), and ok1287 homozygotes (probable early larval arrest). Strain is reasonably well balanced, but requires a bit of care. Presence of coily Uncs among progeny indicates recombination may have occurred; the nature of these animals is not known, but they are usually WT by PCR. Pick WT and check for correct segregation of progeny to maintain. Segregation ratio of WT:Unc should be 2:1 and not 3:1. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC825 |
C. elegans |
+/mT1 II; mrg-1(ok1262)/mT1 [dpy-10(e128)] III. Show Description
Y37D8A.9. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpy mT1 homozygotes, and ok1262 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC828 |
C. elegans |
unc-94(ok1210) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C06A5.7a. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1210 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC829 |
C. elegans |
unc-108(ok1246) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F53F10.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1246 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC842 |
C. elegans |
ZK1248.13&col-74(ok1096)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1248.13, ZK1248.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1096 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VK1241 |
C. elegans |
vkEx1241. Show Description
vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1243 |
C. elegans |
vkEx1243. Show Description
vkEx1243 [nhx-2p::ubiquitin-V::mCherry + myo-2p::GFP]. Increased Ub-tagged mCherry accumulation upon blockage of the proteosome by RNAi. Faint mCherry expression in intestine. GFP+ pharynx. References: Miedel MT, et al. PLoS One. 2012;7(7):e40145. Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460. Dantuma NP, et al. Nat Biotechnol. 2000 May;18(5):538-43.
|
|