Search Strains

Long, weak left-handed rollers in L3 and older.

Weak left-handed roller as adult.

As homozygote suppresses blister formation in bli-1(sc73), bli-2(sc768) and bli-6(sc16). WT phenotype. Males sometimes have small blisters above their bursas. Males mate well. See wbg9.1p51.

Left handed roller. Recessive.

Left roller as adult.

Left hand Roller. Recessive. Temperature sensitive.

Left-handed Dpy Roller. Recessive.

Temperature sensitive. Left hand Roller and Dpy at 25C. Dpyish at 16C. Recessive.

Temperature sensitive. Left hand Roller and Dpy at 25C. Dpyish at 16C. Recessive.

Temperature sensitive. Left hand Roller and Dpy at 25C. Wild-type at 16C. Recessive.

Dominant. Heterozygotes are Rollers. Temperature sensitive. At 25C: homozygotes are Sqt; heterozygotes are rollers. AT 16C: homozygotes are WT (a few adults may roll weakly); heterozygotes are WT. M-MATING+LOW TEMP ONLY.

Adults and L4 animals roll left. Recessive. M-MATING++ 1-10%WT. PKA rol-4.

Adults left-handed rollers.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, Mortal germline (Mrt) at 25C. Expressing nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, germ granule defective, high sterility. Expresses nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germline granules defective, ~30% sterility. Males fail to be attracted by hermaphrodite-secreted volatile sex pheromones. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible AID-1* and HA tag inserted into the endogenous hrde-1 locus. GFP fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

G to A splice acceptor mutation, LG I. position 6561778. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi453 [nhr-82p::FLP_CAI_G5D + unc-119(+)] IV. Heat shock produces green nuclei in the seam cell lineage and red nuclei elsewhere. Might still carry unc-119(ed3) III in background.

bqIs7 [pie-1p::LAP::npp-19 + unc-119(+)]; rescues Emb defects. Rodenas et al, Dev Biol. 2009 327:399-409.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi487 [mec-7p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in mechanosensory neurons and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi488 [tph-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in serotonin-producing neurons and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi494 [hlh-8p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in the M lineage and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. Heat shock produces green nuclei in body wall muscles and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi541 [myo-2p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in pharyngal muscles and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi542 [unc-47p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in GABAergic motor neurons and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi548 [dpy-7p::FLP + unc-119(+)] IV. Heat shock produces green nuclei in the hypodermal cell lineage and red nuclei elsewhere.

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi556 [lag-2p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in lag-2 expressing cells and red nuclei elsewhere.

bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II; bqSi577 [myo-2p::GFP + unc-119(+)] IV. Strain carrying visible markers in the MosSCI loci on chr II (ttTi5605) and chr IV (cxTi10882); facilitates crosses between MosSCI strains with non-visible insertions.

Endogenous maph-1.1 locus tagged with GFP using CRISPR/Cas9. Animals are homozygous viable and express GFP::maph-1.1 ubiquitously. Reference: Waaijers S, et al. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. PMID: 27506200

hyEx30 [myo-2::GFP + des-2::GFP + pBluescript]. Maintain by picking GFP+. Reference: Oren-Suissa M, et al. Science. 2010 Jun 4;328(5983):1285-8.

989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.

byEx655 [pink-1p::pink-1::GFP + myo-2p::mCherry + herring sperm DNA]. Pick mCherry+ animals to maintain. pink-1 translational GFP (C-terminal GFP) fusion generated by cloning the complete pink-1 genomic fragment (3191 bp) with a 6-kb upstream promoter region and into pPD117.01. Reference: Sämann J, et al. J Biol Chem. 2009 Jun 12;284(24):16482-91.

Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.

byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. F3 pro aggregation fragment is expressed at low levels (line B); hard to detect by western blot. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

Reference: Heimbucher T, et al. Nat Commun. 2020 Oct 2;11(1):4627. doi: 10.1038/s41467-020-18369-w. PMID: 33009389.

pwIs23 [vit-2::GFP]. Reference: Heimbucher T, et al. Nat Commun. 2020 Oct 2;11(1):4627. doi: 10.1038/s41467-020-18369-w. PMID: 33009389.

Heterozygotes are fertile and grow more slowly than gld-1(q266) homozygotes. gld-1(q266) homozygotes are sterile and produce small abnormal oocytes. nDf24 homozygotes are dead.

Temperature sensitive. Maintain at 15 degrees. Germline tumor formation at 25 degrees. Proximal proliferations defects. Reference: Pepper et al. (2003) Genetics 163(1):115-32.

F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.

Temperature-sensitive allele. Can be grown at 20C with reduced fertility. Defects in pachytene progression, small oocyte formation and Emo are highly penetrant at 25C. ok154 is a null allele; 1504 bp deletion from -156 bp to +1348 bp, removes the start codon. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236

Ectopic ERK MPK-1 (detected by dpMPK-1 immunostaining) in the loop region. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236

Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type.