| PS1123 |
C. elegans |
unc-31(e169) IV; syIs1 X. Show Description
syIs1 [lin-3(genomic) + rol-6(su1006)]. Animals are Muv due to over-expression of lin-3. Unknown if unc-31(e169) is present in this strain. See also WBPaper00004853. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations.
|
|
| PS1681 |
C. elegans |
dpy-20(e1282) IV; syIs17. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)].
|
|
| PS2037 |
C. elegans |
syIs12 II. Show Description
syIs12 [hsp::lin-3 + dpy-20(+)]. "low dose" overexpressor of the EGF repeat of lin-3 under control of the heat shock promoter. Wild type vulval differentiation when grown at 20C. Muv phenotype resulting from heat shock at L2 lethargis. Reference: Katz WS, et al. Cell. 1995 Jul 28;82(2):297-307. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS2105 |
C. elegans |
dpy-20(e1282) IV; syIs13. Show Description
syIs13 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS3351 |
C. elegans |
dpy-20(e1282) syIs17 IV. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS3722 |
C. elegans |
unc-119(ed4) III; syIs101 IV. Show Description
syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS3724 |
C. elegans |
unc-119(ed4) III; syIs102 X. Show Description
syIs102[T04B2.6::cfp + unc-119(+)] X. Expressed in vulB and vulD. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4198 |
C. elegans |
unc-119(ed4) III; syIs103. Show Description
syIs103[unc-119(+) + pPGF11.13(lin-11::GFP)]. GFP fluoresence is observed in the vulva, uterine pi cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4263 |
C. elegans |
egl-30(md186) I; dpy-20(e1282) IV; syIs105. Show Description
syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.
|
|
| PS4308 |
C. elegans |
unc-119(ed4) III; syIs107. Show Description
syIs107 [lin-3(delta pes-10)::GFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4309 |
C. elegans |
unc-119(ed4) III; syIs108. Show Description
syIs108 [lin-3(delta pes-10)::GFP + unc-119(+)].
|
|
| PS4411 |
C. elegans |
unc-119(ed4) III; syIs123 X. Show Description
syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4441 |
C. elegans |
syIs118 I; unc-119(ed4) III. Show Description
syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4444 |
C. elegans |
unc-119(ed4) syIs129 III. Show Description
syIs129 [hemicentin(delta SP)::GFP + unc-119(+)]. Integrant of hemicentin::GFP reporter where the signal has been deleted. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4558 |
C. elegans |
unc-119(ed4) syIs137 III. Show Description
syIs137 [unc-119(+) + fos-1b::CFP-TX]. Integrant of fos-1b transcriptional reporter. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS4867 |
C. elegans |
syIs146. Show Description
syIs146 [mom-2::GFP + unc-119(+)]. May contain unc-119(ed4).
|
|
| PS4997 |
C. elegans |
unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5332 |
C. elegans |
unc-119(ed4) III; him-5(e1490) V; syIs187. Show Description
syIs187 [pes-10::7XTCF-mCherry-let-858(3'UTR) + unc-119(+)]. Cherry POPTOP. POPTOP expression is best visualized using the mCherry/Texas Red filter. POPTOP transgenes display background expression. POPFOP(sy974) is the control plasmid with mutated binding sites. Analysis of POPFOP should always be used to subtract background expression. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5527 |
C. elegans |
pop-1(q645) I/hT2 [bli-4(e937) let-?(h661)]; syIs187. Show Description
syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5551 |
C. elegans |
pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. Show Description
syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5970 |
C. elegans |
him-5(e1490) syIs197 V. Show Description
syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.
|
|